Обнаженная кристина финк: Голая Кристина Финк на слитых фото

Содержание

в купальнике и нижнем белье

Кристина Финк – привлекательная красотка, которая прославилась яркими и реалистичными косплеями. Девушка ведет свой YouTube-канал, где размещает видеоролики с популярными образами из фильмов, компьютерных игр и комиксов. Особенную роль в ее творчестве играют такие персонажи, как Наруто, Лара Крофт, Харли Квинн и Цири из «Саги о Ведьмаке». Кристина Финк горячие фото приводят в восторг ценителей откровенных костюмированных игр.

Некоторые факты биографии

Кристина Финк родилась 19 января 1997 года в городе Владивосток. С юных лет она увлекалась комиксами, компьютерными играми и часто представляла себя на месте самых ярких персонажей.

Впервые девушка перевоплотилась в героиню из японских мультфильмов «Наруто» для участия в городском фестивале. Новый образ пришелся ей по душе и она всерьез заинтересовалась косплеем.

Карьера Кристины на YouTube началась с канала «Фабрика лайков», благодаря которому она смогла привлечь к себе внимание известных блогеров. Создатель проекта «DaiFiveTop» Ли Кей сделал ей предложение вести рубрику «Один на один», где нужно было сравнивать популярные игры, фильмы и знаменитостей между собой.

Через некоторое время она решила развивать собственный блог, где рассказывала о себе, а также знакомила зрителей с японской культурой. Зрители «Няшного бложика» узнали об искусстве косплея и многом другом.

Горячие фото

В коллекции Кристины Финк много горячих фото, на которых она позирует в соблазнительном нижнем белье или полностью обнаженной. Даже самые откровенные косплеи девушки посвящены героям популярных игр и фильмов в стиле фэнтэзи.

Инстаграм Кристины Финк

Девушка предпочитает не делиться с поклонниками снимками из обычной жизни или фотографиями в купальнике. Ее лента в Инстаграме пестрит яркими фото в пикантных костюмах. Подписчики восхищаются внешними данными юной красотки и ценят ее за оригинальность и качественный косплей.

Оценить косплей «Little Big» Кристины Финк можно в следующем видео:

Возможно вам также будет интересно посмотреть Катя Голышева горячие фото.

Голая Кристина Финк Без Цензуры – Telegraph


➡➡➡ ДЛЯ ПЕРЕХОДА НАЖМИТЕ ЗДЕСЬ!

Голая Кристина Финк Без Цензуры

Глубокое Декольте Жанны Фриске На Шоу «Каникулы В Мексике»

Голая Эллен Пейдж Видео

Стриптизёрши – Эротические Сцены

Полуголая Амалия Мордвинова – Роковые Яйца (1995)

Горюнов – Эротические Сцены

Сердце Справедливости – Эротические Сцены
Голая Алена Дом 2
Голая Хлоя Грэйс
Голая Писька Анны Плетневой
Элегантная Анна Снаткина – Когда На Юг Улетят Журавли (2010)
Кая Скоделарио Обои
Прекрасное Тело Джессики Бил И Ванессы Мотта – Лондон (2005)

Секси Янина Студилина – Остров (Россия) (2020)
Голая Попка Кэрис Ван Хаутен – Черные Лебеди (2005)
Кэти Харрис, Джасмин Савой Браун И Вайолетт Бин Бегают Голыми – Оставленные (2014)
Голая Анна Хилькевич Смотреть Видео Онлайн Бесплатно
Полина Агуреева Засветила Трусики – Эйфория (2006)
Скачать Голая Анна
Голая Грудь Натальи Бочкаревой – Веревка Из Песка (2005)
Голая Пола Маршалл Видео
Анна Лутцева Голая Видео
Секс С Голди Хоун – Город И Деревня (2001)
Алина Бужинская Голая
Секс С Джейн Мэй Грейвз – Ответный Удар (2010)
Анна Матвеева Голая
Секси Стефани Кайлар – Марсель (2020)
Секси Стюардесса Карина Зверева – Однажды В России (2014)
Секс С Одноклассницей В Машине – Старые Денечки (2014)
Обнаженная Лариса Цапусто – Палач (1990)
Секс С Элизой Тейлор – Человек Ноября (2014)
Голая Александра Живова Видео
Голая Карина Зверева Фото
Ким Кардашьян Голая В Ванной
Обнаженная Кейт Уинслет Плавает Под Водой – Айрис (2001)
Голая Америка Оливо Видео
Скарлетт Йоханссон В Бассейне – Обещать – Не Значит Жениться (2009)
Лив Тайлер Разделась – Магазин «Империя» (1995)
Голая Грудь Лины Эско – Королевство (2014)
Лина Данэм Взяла Член В Руку – Девочки (Сериал) (2012)
Голая Рита Ора (35 Фото)
Сексуальная Варвара Бородина В Ночнушке – Свадьбы Не Будет (2014)
Цукаева Анна На Квартире Голая
Интимная Татушка Изабеллы Мико – Бар «Гадкий Койот» (2000)
Кристина Убелс Голая
Голая Нюша Показала Грудь На Пляже
Людмила Нарусова Голая
К Марие Буравлевой Пристают – Аннушка (2009)
Тереза Палмер Принимает Душ – Убей Меня Трижды (2014)
Али Майкл Показала Голую Грудь – Украденные Видео Знаменитостей
Чернобыль: Зона Отчуждения – Эротические Сцены
Ольга Серябкина До Пластики
Грудь Тэнди Ньютон – Мир Дикого Запада (2020)
Голая Франц
Николь Кидман Мастурбирует – Марго На Свадьбе (2007)
Обворожительная Дарья Петрожицкая В Купальнике – Папик (2020)

ВКонтакте – универсальное средство для общения и поиска друзей и одноклассников, которым ежедневно пользуются десятки миллионов человек . Мы хотим, чтобы друзья, однокурсники, одноклассники, соседи и коллеги всегда оставались в контакте .
Откровенные и эротические ню фото Кристина Финк на которых она изображена голой .
СмотриКристина Финк порно видео бесплатно, только здесь на Pornhub . Открой для себя растущую коллекцию высококачественных  Ни один другой из секс-порталов настолько не популярен и ни у одного другого нет таких крутых Кристина Финк сцен как на Pornhub! 

Голая Кристина Финк (65 фото) | Обновлено: 25 уста 2020 . Эрография: Косплей модель Кристина Финк часто позирует голой для тематических фотосессий .  Украденные фотографии (18+) без цензуры только повышают ее популярность . 

Возраст: 30 лет (19 аря 1990г) . Вес: 60 к Рост: 170 см . Талия: 65 см . Бёдра: 90 см . Объём груди: 95 см . Размер груди: 3 . Представляю вашему вниманию подборку откровенных снимков 30-летней российской видеоблоггерши, любительницы аниме и косплея Кристины Финк .
Кристина Финк за короткое время смогла добиться огромных успехов в российском видеоблоггинге . Особую популярность девушка приобрела после участия в «DaiFiveTop» . Основное навление деятельности Финк – косплей . 

Представляю вашему вниманию подборку откровенных снимков 28-летней российской видеоблоггерши, любительницы аниме и косплея Кристины Финк . На данный момент она продвигает собственный YouTube-канал с 537 тыс . подписчиков . . 

Кристина-Кристиночка, что с тобой стало? Была милая девочка, стала жирная проблядь . А все дисгармоника-ссука!  Сисяндры Исламова вообще-то довольно давно нарастила, где-то в конце — начале г Да и сама Кристина не самый хороший человек, что давно известно . 

Кристина финк засветила огромную голую грудь без одежды сиськи кристины финк гол .  Голая кристина финк голые сиськи бабы из дай пять kalikafox раздетая слив patreo . 

Голая Кристина Финк — слитые фото обнаженной видеоблогерши, эротические фотосессии в жанре косплей, с голой грудью, попой и киской без  Таким образом Финк обрела большую популярность и известность . Однако, сотрудничество молодых людей длилось до года .  

Голая Кристина Финк (256 эро фото) . Талантливая видеоблогерша Кристина Финк, родившаяся в Санкт-Петербурге очень любит косплей . Повзрослев, девушка завела собственный канал на Youtube и создала персональный проект «DaiFiveTop» . 

Увидеть голую Кристину Финк можно не только на ее канале, но и в нашей фото коллекции . Здесь собраны самые пикантные снимки (18+), слитые фото и великолепные кадры с фотосессий .  Украденные фото с голой Кристиной Финк . 

Кристина Финк сливы . Аноним 15/03/20 Вск 15:49:20 #1 №144619 .  Кристина-Кристиночка, что с тобой стало? Была милая девочка, стала жирная проблядь .  Существуют ли во вселенной вот эти фотки без цензуры? А то я уже руки стер искать . 

Реальная голая Кристина Финк показала себя своим фанатом . А некоторые фото она не хотела показывать, но Слухи выложили их на общее обозрение .  Откровенные снимки Кристины Финк . Слухи Ваш дорогие друзья решили показать фото топовой блогершы рунета . 

Откровенные и слитые ню фото Кристина Финк на которых она изображена голой .


Кристина Финк (Kalinka Fox) Жанр: Lingerie, Softcore, Cosplay, Alternative, Fetish, Tattoo, Piercing Количество фото: 4469 фото Количество сетов  Добавь в название Kalinka Fox или Кристина Финк по-русски напиши, пожалуйста . Искал месяц назад, пришёл с зарубежных трекеров качать . 

Кристина Финк – это довольно известная косплейщица, по совместительству видеоблогер, а иногда даже и стример . В сети также известна как — Kalinka Fox . В общем, девушка пробует себя во всех сферах, где можно показать себя и получить за это долю популярности . 

Голая кристина финк голые сиськи бабы из дай пять kalikafox раздетая слив patreo .  Кристина финк засветила голые сиськи соски без одежды голые блогерши слив приват . 

Горячие фото Кристины Финк . Кристина Финк (она же Калинка Фокс – таков новый псевдоним) – известная российская косплей-модель . Благодаря природному обаянию и ярким образам, она смогла завоевать огромную популярность не только в России и СНГ . . 

Слитые фото Кристины Финк бесплатно . Думаю многие ищут фото с этой девицей, которая так же в мире косплея известная как Калинка Фокс . Здесь мы собрали хорошую подборку фотографий с Кристиной . У нее такое красивое лицо и к тому же милая улыбка . 

ВКонтакте – универсальное средство для общения и поиска друзей и одноклассников, которым ежедневно пользуются десятки миллионов человек . Мы хотим, чтобы друзья, однокурсники, одноклассники, соседи и коллеги всегда оставались в контакте .
Откровенные и эротические ню фото Кристина Финк на которых она изображена голой .
СмотриКристина Финк порно видео бесплатно, только здесь на Pornhub . Открой для себя растущую коллекцию высококачественных  Ни один другой из секс-порталов настолько не популярен и ни у одного другого нет таких крутых Кристина Финк сцен как на Pornhub! 

Голая Кристина Финк (65 фото) | Обновлено: 25 уста 2020 . Эрография: Косплей модель Кристина Финк часто позирует голой для тематических фотосессий .  Украденные фотографии (18+) без цензуры только повышают ее популярность .  

Возраст: 30 лет (19 аря 1990г) . Вес: 60 к Рост: 170 см . Талия: 65 см . Бёдра: 90 см . Объём груди: 95 см . Размер груди: 3 . Представляю вашему вниманию подборку откровенных снимков 30-летней российской видеоблоггерши, любительницы аниме и косплея Кристины Финк .
Кристина Финк за короткое время смогла добиться огромных успехов в российском видеоблоггинге . Особую популярность девушка приобрела после участия в «DaiFiveTop» . Основное навление деятельности Финк – косплей . 

Представляю вашему вниманию подборку откровенных снимков 28-летней российской видеоблоггерши, любительницы аниме и косплея Кристины Финк . На данный момент она продвигает собственный YouTube-канал с 537 тыс . подписчиков . . 

Кристина-Кристиночка, что с тобой стало? Была милая девочка, стала жирная проблядь . А все дисгармоника-ссука!  Сисяндры Исламова вообще-то довольно давно нарастила, где-то в конце — начале г Да и сама Кристина не самый хороший человек, что давно известно . 

Кристина финк засветила огромную голую грудь без одежды сиськи кристины финк гол .   Голая кристина финк голые сиськи бабы из дай пять kalikafox раздетая слив patreo . 

Голая Кристина Финк — слитые фото обнаженной видеоблогерши, эротические фотосессии в жанре косплей, с голой грудью, попой и киской без  Таким образом Финк обрела большую популярность и известность . Однако, сотрудничество молодых людей длилось до года . 

Голая Кристина Финк (256 эро фото) . Талантливая видеоблогерша Кристина Финк, родившаяся в Санкт-Петербурге очень любит косплей . Повзрослев, девушка завела собственный канал на Youtube и создала персональный проект «DaiFiveTop» . 

Увидеть голую Кристину Финк можно не только на ее канале, но и в нашей фото коллекции . Здесь собраны самые пикантные снимки (18+), слитые фото и великолепные кадры с фотосессий .  Украденные фото с голой Кристиной Финк . 

Кристина Финк сливы . Аноним 15/03/20 Вск 15:49:20 #1 №144619 .  Кристина-Кристиночка, что с тобой стало? Была милая девочка, стала жирная проблядь .  Существуют ли во вселенной вот эти фотки без цензуры? А то я уже руки стер искать .  

Реальная голая Кристина Финк показала себя своим фанатом . А некоторые фото она не хотела показывать, но Слухи выложили их на общее обозрение .  Откровенные снимки Кристины Финк . Слухи Ваш дорогие друзья решили показать фото топовой блогершы рунета . 

Откровенные и слитые ню фото Кристина Финк на которых она изображена голой .
Кристина Финк (Kalinka Fox) Жанр: Lingerie, Softcore, Cosplay, Alternative, Fetish, Tattoo, Piercing Количество фото: 4469 фото Количество сетов  Добавь в название Kalinka Fox или Кристина Финк по-русски напиши, пожалуйста . Искал месяц назад, пришёл с зарубежных трекеров качать . 

Кристина Финк – это довольно известная косплейщица, по совместительству видеоблогер, а иногда даже и стример . В сети также известна как — Kalinka Fox . В общем, девушка пробует себя во всех сферах, где можно показать себя и получить за это долю популярности . 

Голая кристина финк голые сиськи бабы из дай пять kalikafox раздетая слив patreo .  Кристина финк засветила голые сиськи соски без одежды голые блогерши слив приват .  

Горячие фото Кристины Финк . Кристина Финк (она же Калинка Фокс – таков новый псевдоним) – известная российская косплей-модель . Благодаря природному обаянию и ярким образам, она смогла завоевать огромную популярность не только в России и СНГ . . 

Слитые фото Кристины Финк бесплатно . Думаю многие ищут фото с этой девицей, которая так же в мире косплея известная как Калинка Фокс . Здесь мы собрали хорошую подборку фотографий с Кристиной . У нее такое красивое лицо и к тому же милая улыбка . 


Кристина финк голая — энцеклопедия секса

Голая Кристина Финк фото в откровенном виде. Хотите бесплатно посмотреть на голую Кристину Финк? Да запросто. Смотрите сколько хочется, сиськи и пизда. — Это я хотел спросить! Чего ты тут устроила ночь живых мертвецов?!

Красотка голая Кристина Финк известна как звезда косплея в русскоязычном сегменте Интернета. Помимо переодеваний в различных персонажей, девушка ведет youtube-канал и. Смотреть на них не хотелось, взгляд прилипал сам собою к длинным женским ногам из-под задранного платья

Кристина Финк засветила голые сиськи соски без одежды голые блогерши слив приват. 5 months ago 11,7k 00:21. Кристина Финк голая сиськи показала в ванной onlyfans nude porn sex. Ну возьмут их, ну навесят «легкие телесные повреждения», и все, аллес!

СмотриКристина Финк порно видео бесплатно, только здесь на Pornhub. Открой для себя растущую коллекцию высококачественных наиболее актуальным XXX фильмов и клипов. — Чудеса! — сказал безымянный герой развязно и громко, будто озвучил чужие мысли

Украинская крошка Christina Eldar обнаженная в душе. Обнаженные сиськи и соски Christina Ricci в стоне черной змеи. Дощатый стол весь в следах от «бычков», консервные банки соседствовали с пустой стеклотарой, постель на широком топчане разворошена и замурзана

Ты не найдешь другого такого секс сайта, как Порнхаб, с таким количеством Голая Кристина Финк сцен! Смотри нашу впечатляющую выборку порно видео в HD качестве на любом гаджете. Вдобавок цивилизация с каждым шагом напоминала о себе

СмотриФинк Кристина порно видео бесплатно, только здесь на Pornhub. Открой для себя растущую коллекцию высококачественных наиболее актуальным XXX фильмов и клипов. — Э-э, Европа-шмаропа! — отмахнулся Акоп презрительно, будто и не корчил из себя час назад ЖЕНТЕЛЬМЕНА

Кристина Финк голышем разделась и засветила пизду без одежды и белья голая блогерша c DaiFiveTop голышом слив приватных видео из. — Наташу? — переспрашивает Глеб глуповато, и что-то внутри вдруг смещается, будто тяжелый старый карп в мелком водоемчике

Кристина Финк (Kalinka Fox). 1612 фотографийКомментарии к альбому. Показать больше фотографий. А между тем коррупция и казнокрадство были порождением советского застоя

Pornhub может похвастаться бесплатными Большая грудь видео, в которых представлены сотни порнозвезд. Если ты без ума от big boobs порно, ты точно найдещь его здесь. Ростки будущих дел, зародыши крутых реализаций… бумаги, короче

Талантливая видеоблогерша Кристина Финк, родившаяся в Санкт-Петербурге, уже в юности понимала, что ей нравится косплей. Повзрослев, девушка завела собственный канал на. А я, может, просто кайф ловлю от жизненной простоты

Кристина Финк – молодая и очень привлекательная девушка. Она известна благодаря своим качественным и очень реалистичным косплеям. Среди ее любимых персонажей Цири из. В соседней комнате опер постарше опрашивал вертлявого парня с гопническими манерами

104,493 кристина финк FREE videos found on XVIDEOS for this search. кристина финк (104,493 results). А между тем коррупция и казнокрадство были порождением советского застоя

Фотографии голой Кристины Финк. Кристина Финк родилась 19 января 1990 года в Санкт-Петербурге, и до повсеместного распространения интернета, была обычной девушкой. — Серый с Джоном и Барсук, они у нас отморозки! Есть «фазенда» за Одинцовом, они там квасят!

Кристина Финк девушка Эротика песочница эротики. В этом разделе мы собираем самые смешные приколы (комиксы и картинки) по теме кристина финк голая (+1000 картинок). Макс, впрочем, воспитан иначе и выжимать тебя будет, как кота в анекдоте, до последней капли

Christina Fink (Kalinka Fox) is a Russian Cosplayer and Model. This sub is a home for Christina Fink related content whether it be Cosplay, Sexy or just Causal. When posting content please follow the. Я ведь в этом городе выросла, есть кому заступиться

Кристина-Кристиночка, что с тобой стало? Была милая девочка, стала жирная проблядь. А все дисгармоника-ссука!.  — Нам предлагается поляна в лесу, куда приедут вооруженные люди с претензиями

. смешные приколы (комиксы и картинки) по теме Кристина Финк (+37 картинок, рейтинг 793. 5 — Кристина Финк). Кристина Финк. Подписчиков: 1435 Сообщений: 37 Рейтинг постов: 793. 5. Один, при ближайшем рассмотрении, оказался старым знакомым, а во втором был опознан американский журналюга из подзабытого прошлого, специалист по митинговым шоу

Читайте самые интересные и обсуждаемые посты по теме Кристина Финк. Личный опыт, познавательные статьи, забавные фото и видео. Или поделитесь своей историей с тегом. Где-то здесь, у черты с надписью «безнадега» таятся самые отчаянные шаги: в петлю, в монастырь, в развод, в другую жизнь

Слитые фото Кристины Финк бесплатно. Думаю многие ищут фото с этой девицей, которая так же в мире косплея известная как Калинка Фокс. Здесь мы собрали. Кости сделаны изо льда, в кишках иней, мышцы сводит судорогой

Порно фото: Кристина Финк. 1 244. Голая Cortana. 1 601. Красивые болшие сиськи Кристины Финк. 373. Секси девушка в косухе. 815. Кристина Финк в лифчике и трусиках. 250. Человек, сидящий сейчас напротив, от гайтановской будущей агентуры отличается соответственно — как доцент солидного вуза от пропитого таежного охотника

Кристина Финк – привлекательная красотка, которая прославилась яркими и реалистичнымиКристина Финк горячие фото приводят в восторг ценителей откровенных костюмированных игр.  — Валите, не нервируйте женщину! Ты… нож брось, ну! Вот та-ак! А для вас, красавица, чай готов, можете остаться

Эротика,красивые фото обнаженных, совсем голых девушек, арт-ню,сиськи,попа,длиннопост,медсестра,Кристина Финк. — Люблю так посидеть, с другом на свежем воздухе! — признался Акоп, когда пары «Ноя», наконец, распечатали разговорные центры

Кристина Финк слив фото. Патрон Christina Fink слитые фото. Сама Christina Fink слитые фото не комментит. По всей видимости виной тому биография Крис, которая интересна и проста. Бывшая дворовая гоп-команда, пускавшая лет пятнадцать назад по кругу бутылку портвейна, косячок, а то и шприц

Реальная голая Кристина Финк показала себя своим фанатом. Кристина Финк 28 лет и у нее на данный момент порядка 600. 000 подписчиков на YouTube-канале.  — Это было всего двести двадцать вольт, а дальше по нарастающей

Голая Кристина Финк. Видно её сиськи, киску и попку! Обнаженная косплееровидеоблоггерша

Голая звезда интернета Кристина Исламова. Большие сиськи, волосатая киска и упругая жопа. Много порно фото без цензуры. Раздетая видеоблогерша ведущая свой канал «Няшный Бложик» на YouTube. Обнаженная косплеер.

Эротика и порно без купюр, и цензуры. Эксклюзивные интимные фотографии.

Эксклюзив! Это должен увидеть каждый! Только для лиц старше 18 лет. Эротические и откровенные фотографии. Коллекция бесплатных эротических и сексуальных фотографий с голой Финк.

Она показывает всем свою волосатую пиз** и огромные сиськи. Видно её большие сиськи и мокрую волосатую киску.

Для Вас, подборка фотографий с полностью обнаженной Финк. Насладитесь её совершенными оголенными формами. Самая сексуальная россиянка. Она покорила всю мужскую аудиторию.


Дата рождения: 19 января 1990 г. Город: Санкт-Петербург.

Самые популярные в 2021: Голая Юлия Тимошенко , Голая Клава Кока , Голая Валя Карнавал , Голая Юля Гаврилина , Голая Аня Покров , Голая Карина Кросс , Голая Диана Шурыгина , Голая Дина Саева , Голая Полина Гагарина , Голая Настя Ивлеева на горячих фото в 2021 году , Голая Инстасамка , Голая группа Тату , Голая Марьяна Ро , Голая Марина Кравец , Голая Кристина Асмус , Голая Настя Волочкова , Голая Ким Кардашьян , Голая Ольга Медынич , Голая Зоя Бербер , Голая Мила Сивацкая , Голая Анна Хилькевич , Голая Нелли Уварова , Голая Юлия Волкова из Тату , Голая Мария Кожевникова , Голая Настасья Самбурская , Голая Елена Катина из Тату , Голая Ирина Сопонару , Голая певица Оля Полякова , Голая Яна Кошкина , Голая Ольга Олексий , Голая Виктория Булитко , Голая Ольга Бузова , Голая Леся Никитюк , Голая Яна Глущенко , Голая Анна Саливанчук , Голая Ольга Скабеева , Голая Елена Кравец , Голая певица Пелагея , Голая Анна Кошмал , Голая Елена Малышева , Голая Лариса Гузеева , Голая Ирина Пегова , Голая Софья Каштанова , Голая певица Си Си Кетч , Голая Регина Тодоренко , Голая Анастасия Квитко , Голая Наташа Королёва , Голая Алина Ланина-Кизиярова , Голая Анастасия Гулимова , Голая Диана Пожарская , Голая Ольга Рапунцель , Голая Олеся Фаттахова , Голая Меланья Трамп , Голая Юлия Белая , Голая Юлия Ефременкова , Голая Ольга Серябкина , Голая Ида Галич , Голая Юлия Франц / Дзуцева , Голая Алина Алексеева , Голая Мерьем Узерли , Голая Татьяна Бабенкова , Голая Елена Степаненко , Голая Ульяна Васькович , Голая Яна Троянова . активно набирают популярность: Голая Анастасия Ивлеева (Слив Насти Ивлеевой 2021) , Голая Анастасия Уколова / Зенкович , Голая Билли Айлиш , Голая Айза Анохина / Долматова , Голая Настя Усеева , Голая Маха Горячёва , Голая Диана Астер , Голая Катя Голышева , Голая певица Дора , Голая Валентина Рубцова , Голая Екатерина Радченко , Голая Анастасия Чистякова , Голая Елена Ландер , Голая Ольга Дибцева , Голая Дарья Мороз , Голая Паулина Андреева , Голая Виктория Заболотная , Голая Александра Флоринская , Голая Екатерина Кабак , Голая Кристина Казинская , Голая Анастасия Акатова , Голая Наталья Костенёва , Голая Яна Енжаева , Голая Арина Постникова , Голая певица Рита Дакота , Голая Виктория Агалакова , Голая Светлана Чуйкина , Голая Валентина Мазунина , Голая Лиза Арзамасова , Голая Линда Лапиньш , Голая Ирина Сотикова , Голая Василина Юсковец , Голая Рина Гришина , Голая Екатерина Олькина , Голая Варвара Шмыкова , Голая Алёна Михайлова , Голая Екатерина Шумакова , Голая Александра Никифорова , Голая Ангелина Татишвили из Дома 2 , Голая Элина Камирен из Дома 2 , Голая Полина Гренц , Голая Рита Керн из Дома 2 , Голая Ксения Суркова , Голая Лариса Баранова , Голая Ника Шукурова из Дома 2 , Голая Ангелина Миримская , Голая Ольга Лерман , Голая Анастасия Кочервей , Голая Дарина Маркина , Голая Алья Адхам . Голые участницы из шоу Дом-2 (горячие фото): — Часть первая , Часть вторая , Часть третья . Главная страница , Горячие фото, украденные и слитые интимные фото звезд , Слив голых тиктокерш , Слитые фото знаменитостей без ретуши и цензуры , Голые селебрити — Горячие порно сливы знаменитостей , Крупнейшая коллекция фотографий обнаженных звезд , Голые знаменитости в Плейбой , ГОЛЫЕ И ОБНАЖЕННЫЕ ДЕВУШКИ , Голые блогерши , Голые спортсменки , Отсортированные знаменитости по самым популярным именам , Голые актрисы , Голые певицы , Голые телеведущие , Голые русские девушки , Голые украинские девушки , Голые политики , Голые модели , Сиськи знаменитостей , Голые звезды в журнале Максим , В тренде: Топ-20 самых сексуальных! Годовой рейтинг , Голые турецкие девушки , Голые из Дома 2 . Только 18+! Сайт содержит материалы для взрослых 18+. Сайт предназначен исключительно для лиц старше 18 лет!

Игровой косплей от Кристины Финк

Подумалось тут мне, что на сайте не хватает тематики «прекрасного». Я сейчас, конечно же, веду речь о косплее. На тематику видеоигр конечно же, и, само собой, с прекрасными девушками. А потому было решено периодически начать выкладывать подборки по косплейным фотографиям, найденным на просторах интернета. Подборки будут самыми разными: персонажи, косплееры, игры, обои на рабочий стол для компьютера (широкоформатные) и для телефона (вертикальные). Да и просто буду делиться тем, что накопилось у меня в моей папке на жестком диске за долгие годы.

И сегодняшняя подборка будет посвящена русской косплеерше Кристине Финк. Она же finkchan, она же Kalinka fox. Я бы мог рассказать вам о том, что родилась она 19 января 1990 года в Питере, о том, как она начинала свою карьеру, о том, что она любит, но будем честными, мы тут собрались не ради этого, да и подобную информацию найти в интернете довольно легко. Я же предлагаю просто получить эстетическое удовольствие, лицезрев фотографии этой невероятно симпатичной и обворожительной девушки (на мой личный взгляд, конечно). В подборке будут лишь те фотографии, которые касаются видеоигровой тематики.




И да, Кристина Финк частенько снимается и полностью обнаженной, то есть голой, в своих «образах». Потому не удивительно, что такие запросы, как «Кристина Финк слитые фото» и «Кристина Финк порно» довольно часто вбиваются в поисковиках. Понятное дело, что подобное я на сайте выкладывать не буду, тут будет всё более-менее прилично, если что я вас проинформировал. Поблагодарите потом в комментариях.

   1. Косплей по вселенной игры Ведьмак

Косплея по Ведьмаку у Кристины Финк довольно много. Есть косплей и на суккуба, и на Трисс, и на Йениффер, и даже на Цири. Смотрим, любуемся, останавливаем руку, тянущуюся под стол.


















2. Косплей по Overwatch

Ну, куда без этого, верно? В подборку косплея от Kalinka Fox я включил только фотки по ДиВе и Трейсер, хотя помимо этого находил еще Мей и вдову. Но там качество не устроило.









3. Косплей по League of Legends

Я просто не мог пройти мимо косплея Кристины по персонажу Jinx. Это же своего рода Харли Квинн мира League of Legends. Обожаю этот образ. Ну и еще косплей Ahri в придачу.








4. Косплей по DC Comics

Некоторые не согласятся, ведь это косплей по комиксам, а не играм. Да, по сути так и есть. Но ведь на консолях и ПК выходили аж две части Injustice. Да и по Бэтмену было несколько игр, где фигурировала Харли. Так что, почему бы и нет?








5. NieR: Automata

Я знаю, на сайте есть любители NieR: Automata. ловите косплей 2b.








6. Косплей по Bioshok

Не знаю, есть ли тут фанаты Элизабет, но косплея по ней завезу.







  7. Косплей по Darkstalkers

Из всей подборки, данная игра является единственной, о которой я не знаю ничего. Да и персонажа этого я только по косплеям и знаю. Но это ни капли не мешает насладиться фото.





  8. Косплей по Боузетте.

Да, закончить я решил на персонаже, который не совсем игровой. Так как в играх его не существует. Но тематика около игровая. Даже очень близкая к играм, так что я решил и её включить в сборку.




СМОТРИТЕ ТАКЖЕ:

Лучший косплей Трисс из The Witcher 3 от Кристины Финк

Новогодний косплей по The Witcher 3: Трисс, Йеннифер и Цири (20 фото)

Bloodborne — лучший косплей Куклы и Леди Марии (25 фото)

Красивый косплей Джейд и Милины из Mortal Kombat (17 фото)

Отечественный косплей 2B из Nier Automata

Кристина си голая — Википедия для взрослых

21 мар 2016 Подборка фотографий с абсолютной голой российской певицей. Посмотрите как выглядит голая Кристина Си. — Чтобы убедиться в том, что вы сумасшедшая, — усмехнулся Хьюстон

Слив кристина финк: секс, порно, видео, porno, porn, ХХХ, sex, XXX, seks, онлайн, смотреть, бесплатно. кристина си голая. кристина голая Личное. — Вообще-то только отец имеет законное право распоряжаться деньгами

Желаешь посмотреть голую Kristina Si? На нашем сайте мы разместили сборку наиболее откровенных фоток с сексуальной Kristina Si, которая . Достав пачку сигарет, я неторопливо закурил и швырнул спичку в камин

Голая Кристина Си мелкие сиськи, бритая киска и аппетитная попка российская исполнительница в стиле RnB и Soul Обнаженная певица Kristina Si . В темноте громыхнул выстрел, и песок рядом со мной взорвался фонтанчиком

На данной странице содержатся материалы предназначенные исключительно для лиц достигших совершеннолетия! Порно видео \. Меня уже стало мутить от выпитого, и я, запрокинув голову, закрыл глаза

Фотография 25 из альбома Кристина Саркисян голая, фото Kristina Si — Фото от 31 июля 2017. Я подумал, что вряд ли могу рассчитывать на теплый прием и радушное гостеприимство

27 сен 2019 Также обнаженная актриса засветилась в максим. Фотографии получились неоднозначными. Крис в роли девушки-воина, но она не . — Неужели вы до сих пор со мной не согласны, мистер Хэзлтон? — спросил он

25 дек 2019 Голая Кристина Си (Певица) Кристина Си (Певица). Голая Ольга Серябкина (Molly, Серебро) · Голая Дарья Мельникова (Актриса). Не уверена, что смогу одна пережить сегодняшнюю ночь

ВКонтакте – универсальное средство для общения и поиска друзей и одноклассников, которым ежедневно пользуются десятки миллионов человек. Мы пытались объяснить это мистеру Хэзлтону, но он и слушать нас не захотел! Марта постоянно следит за мной

Кристина Эльхановна Саркисян (род. 9 марта 1991, Петропавловск, Казахская ССР), более известная под сценическим псевдонимом Kristina Si — . Пете, поджидая меня, продолжал молоть все тот же вздор, что и обычно

Фото голая Кристина Си. Помимо своей эстрадной популярности, имеет неплохую востребованность в мире голых знаменитостей. Голая Кристина Си .  — Вы не соображаете, что говорите! Зачем мне было убивать Филиппа и Клемми?

Загрузка sosetgluboko. sovratili · ГЛАВНАЯ СТРАНИЦА / k. kristina si голая. Утерянные kristina si голая. Тэги: kids ню фото · katya mukhina porn. Так что, Дэнни, если вы решите выгодно продать меня какому-нибудь шейху, у вас появился шанс

Кристина Си фото голой с различных съёмок и фотосессий. Откровенные снимки звёзд на nuznam.  — У нас и без ваших бредовых фантазий хватает проблем!

Кристина си голая. Мне нравится Мне не нравится. 80% (1 голос). Информация; Поделиться; Комментарии (0). Длительность: 0:55 Просмотров: 146 . Потом поднялся, слегка размял затекшие мускулы, набросил халат

Вы попали на страницу, на которой анходится порно видео Фото голая кристина си. Здесь вы сможете произвести ряд всевохможных манипуляций над .  — Я так и знала! Я бы очень хотела, чтобы вы убили его!

22 июл 2020 Cras vehicula diam vitae est commodo mattis. Maecenas pretium eu nisl sodales scelerisque. Mauris rutrum purus iaculis, elementum ante .  — Меня интересуют любые предложения, если они хорошо оплачиваются

Кристина Си, стала популярной певицей после того, как заключила контракт со студией Black Star. Миниатюрная брюнетка с прямыми волосами любит . Сеновал! Я быстро подошел к лестнице и, осторожно ставя на ступеньки ноги, стал подниматься

7 дек 2020 Кристина модель. Kristina c. Насильно. 03:39 Кристина Асмус Голая (Сцена Из Фильма Текст) hardteens. co, маленькие сиськи, эротика, . С вас еще не снято обвинение в неосторожном наезде

1. 7m Followers, 902 Following, 18 Posts — See Instagram photos and videos from Kristina Si (@kristina_si). Она повесила трубку, оставив меня в полнейшей растерянности

Кристина си голая. Мне нравится Мне не нравится. 100% (1 голос). Информация; Пожаловаться; Скриншоты; Поделиться; Комментарии (0).  — Здесь я вам могу показать то, из чего вырастает хлеб

— Опасность, конечно, есть, но, думаю, в Нью-Йорке мне бояться нечего

Смею вас уверить, он размещен довольно сложным образом

Она просила вас навестить ее вечером с восьми до одиннадцати в отеле «Шарантон»

 — Меня вы, очевидно, знаете, так что я представляться не буду

Прежде чем отправиться на ферму, я хорошенько подкрепился в ресторане отеля

кристина финк слив платных фото

кристина финк слив платных фото

Слив Кристины Финк. Собираем все актуальное только в этой теме. Кстати, если перейти в основной раздел, можно посмотреть кучу сливов и найти свою одноклассницу. + у нас есть Сливы стримерш  кристина финк кристин финк кристина финк слив кристина финк фото кристина финк слив фото кристина финк слитые кристина финк слитые фото гол кристина финк кристин финк голая голая кристина финк кристина финк 2ch кристина финк патрон christina fink финк финк слив финк фото слив фото финк голая финк 2ch финк финк патрон.

Кристина Финк — женщина, ставшая известной как стримерша в стиле косплей, затем сменившая квалификацию на блогерскую. Обязана популярности тем людям и их проектам, которые ее (за что-то) продвигали, первым был некто Ли Кей с ютуба. Попала во внимание газетчиков и даже сумела отличиться, попав в список сексуальных стриммерш. Любит показывать свое полуобнаженное тело на радость малолетним поклонникам. Любит позировать в образе лисы в том, в чем мать родила.

Главная » Рейтинг сайтов » Кристина финк слив фото 2ch. Кристина финк слив фото 2ch — Рейтинг сайтов по тематике. 0/5.0 оценка (Голосов: 0). Кристина Асмус — Фото, Биография, Новости, Видео. Кристина Асмус: фото, видео, биография, фильмографияКристина Игоревна Асмус появилась на свет 11 апреля 1988 года в подмосковном городке Королёве. Мать и отец – Игорь Львович и Рада Викторовна – встретились и создали семью в Саратове, там же пр asmuskristina.ru.

Фотография недоступна этому человеку. Чтобы отметить человека, наведите на него курсор и нажмите левую кнопку мыши.Чтобы отметиться на фото, наведите на себя курсор и нажмите левую кнопку мыши. + 1 минута. за просмотры фотографий! 00:46. Кристина Финк в купальнике. 2 июл 20161 462 просмотра. Комментировать0. 0. 2. Группа Кристины: https://vk.com/kristinafink Сама Кристинка: https://vk.com/christina_fink •••.

Слив фоток с patreon Кристины Финк kalinkafox.  Слив фоток с patreon Кристины Финк kalinkafox. Open a Channel via Telegram app. Preview channel. Don’t have Telegram yet? Contact via web telegram. or. Get telegram app.

Смотреть профили людей по имени Кристина Финк. Присоединяйтесь к Facebook, чтобы связаться с Кристина Финк и другими вашими знакомыми. Facebook  Войдите или зарегистрируйтесь на Facebook, чтобы общаться с друзьями, родственниками и знакомыми.

Кристина Финк за короткое время смогла добиться огромных успехов в российском видеоблоггинге. Особую популярность девушка приобрела после участия в «DaiFiveTop». Основное направление деятельности Финк – косплей. Ниже вы найдете самые пикантные и горячие фото Кристины, слитые на сайты 2ch и Patron. Кристина Финк: биография. В интернете часто задают в поисковиках вопрос, сколько ей лет. Кристина Финк родилась 19 января 1990 года и в этом 2018 году ей, соответственно, 28 лет. У Кристины Финк есть свой канал на ютюбе, где она регулярно выкладывает видео в жанре аниме, косплей и фандом. В основном,

Get in touch with Кристина Финк (@finkkristinashs039) — 145 answers, 28 likes. Ask anything you want to learn about Кристина Финк by getting answers on ASKfm.   Давай последнюю фотки из своего телефона. over 1 year ago. 0.

Обои для рабочего стола. косплей, Финк, обои кристина финк, КристинаФинк, Кристина Финк обои (фото, картинки). Ежедневно новые картинки, заставки и только красивые обои для рабочего стола совершенно бесплатно. войти.

кристина финк слитые фото 2ch. Previous Story. Слив Ивлеевой Насти горячие фото. Next Story. слив фото легендарной леи LegendaryLea. Submit a Comment. Cancel reply.

Cопоставимый по уровню прекрасности косплей Рюко делала, кстати, тоже русскоговорящая красотка — Кристина Финк в компании с Жанной Виноградовой. Коммент 2X2. И еще ложку патриотизма в этот чатик! kill la kill, косплей, nsfw. Телеканал 2×2. Подписывайся на новости гик-культуры! с доставкой в почту.

Голая и обнаженная Кристина Финк на фото, включая слитые.  Я же предлагаю просто получить эстетическое удовольствие, лицезрев фотографии этой невероятно симпатичной и обворожительной девушки (на мой личный взгляд, конечно). В подборке будут лишь те фотографии, которые касаются видеоигровой тематики. И да, Кристина Финк частенько снимается и полностью обнаженной, то есть голой, в своих «образах». Потому не удивительно, что такие запросы, как «Кристина Финк слитые фото» и «Кристина Финк порно» довольно часто вбиваются в поисковиках. Понятное дело, что подобное я на сайте выкладывать не буду, тут будет всё более-менее прилично, если что я вас проинформир

Откровенные фотографии 28-летней российской косплей модели Кристины Финк ВК Кристина Финк Инста Кристина Финк.  Кристина Финк. Девушки 27 февраля 2019, 11:35. Откровенные фотографии 28-летней российской косплей модели Кристины Финк. ВК Кристина Финк. Инста Кристина Финк. девушки, модель

Кристина Финк (Kalinka Fox) представляет смертоносность, очарование и силу в шикарном косплее на Элизабет по мотивам BioShock Infinite в следующем фотосете! Точность её макияжа и выбора гардероба поразительно хороша! | Overclockers.ru — крупнейший информационный сайт России посвященный компьютерам, мобильным устройствам, компьютерным играм, электромобилям и информационным технологиям.

Биография. Кристина Финк много работала над собой, чтобы достичь совершенства. Усилия окупились, она стала популярным блогером и завоевала признание в Сети. Она родилась 19 января 1997 года во Владивостоке. О других подробностях ранней биографии ничего не известно. Блог. Увлечение косплеем началось с создания образа главного героя аниме «Наруто» для городского фестиваля. Девушке блестяще удалось вжиться в образ любимого персонажа, что вдохновило продолжить заниматься этим на уровне хобби. View this post on Instagram. A post shared by Калинка Фокс (@finkchan) on Jan 19, 2019 at 3:11am PST. Крис

Платное повышение прав. Выход. Переписки.  слив Christina_Fink. Тема в разделе «Слив фото 18+», создана пользователем yg1, 26 авг 2019. Запрещено размещение ЦП и жесткой порнографии! Надеемся на ваше понимание!

Кристина Финк представила свою последнюю работу – косплей-кроссовер персонажей из двух разных вселенных. Это танцующий клоун Пеннивайз, главный антагонист романа Стивена Кинга «Оно» и его экранизаций, а также Харли Квинн – подруга Джокера из комикс-вселенной DC. Остальные работы девушки вы можете найти на её странице ВКонтакте. Фотограф: Aku. Костюм: Елена Ломакина. Другие образы Кристины Финк: Также по теме. Также по теме.

Кристина Финк или Kalinka Fox создала собою женскую версию Рикардо Милоса. Я решила поставить разную музыку Смотреть Фем-версия Рикардо ТАКОЕ ДЕЛАЕТ 22 175 просмотров 11 месяцев назад. Подборка личных эротических фото Кристины Финк https://goo.gl/ia6oPp. Смотреть Кристина Финк Выложила личные фото!!!!  Сиськи Кристины Финк слив личных фото. 2 306 просмотров 1 год назад. Еще много всякого тут https://t.me/joinchat/AAAAAFASx0PRcdhmMPY6vg. Смотреть ШОК! Кристина Финк голая! Косплеерша голая. 2 020 просмотров 1 год назад. I’ve Just Hit 15000 Views Of When I Did Shows With One Of My Good Pals Christina Fink, The Shows I’ve Done With Christina Смотреть

Слитые фото Кристины Финк. Тема в разделе Оффтопик создана пользователем Gudvin# 14 фев 2018. 3541 просмотр. Загрузка Gudvin# Автор темы 14 фев 2018 Заблокирован 39 10 дек 2016. лазил по инету, там темы на форумах под хайдом. может у кого есть, без хайда? Слейте!

Кристина Финк Слив — анализ группы ВКонтакте, рейтинг и статистика, список участников, фотографии и видеозаписи.  у сообщества установлено главное фото. не верифицировано администрацией ВКонтакте. Необязательное условие, однако при его выполнении сообщество гарантированно попадает в рейтинг.

Слив Кристины Финк. Тема в разделе «Флудилка», создана пользователем NISA228, 30 окт 2019. Метки  СЛИВ Слив шкур с Лукового сайта. xXx_oxpaHa_xXx, 23 янв 2019, в разделе: Сливы. Ответов: 16.

Представляю вашему вниманию подборку откровенных снимков 28-летней российской видеоблоггера, любительницы аниме и косплеера Кристины Финк. На данный момент она продвигает собственный…  Представляю вашему вниманию подборку откровенных снимков 28-летней российской видеоблоггера, любительницы аниме и косплеера Кристины Финк. На данный момент она продвигает собственный YouTube-канал с 537 тыс. подписчиков, премиум-аккаунт Patreon и принимает активное участие в модельном бизнесе.

Российская косплеерша Кристина Финк косплеит подарок под новогодней ёлкой! С ленточками и всё такое. Под катом!Косплей всякий бывает  Вот на старом фото девушка Кристина. Ей еще 16 лет. Девочка как девочка. Таких тысячи. Но Кристина хотела быть особенной. И стала особенной. Подробнос Кристина Хендрикс — большая подборка. Подборка фотографий одной из самых сексуальных девушек планеты, Кристины Хендрикс. 15. 4798.

финк Инстаграм фото | stapico.com (webstagram.ru) — лучший Инстаграм просмотрщик!  Рада встретиться и обняться вживую. #comicconrussia2017 #игромир2017 #косплеер #видеоблогер #Кристина #Финк #няшныйбложик #спасибо. 823 1. Наконец-то нашел Трисс и ещё бонусом Кристину в её привычном образе))) #Рав #ИгроМир2017 #Москва #Финк. 19 0. #Финк #Игромир.

Сливы и лайфстайл знаменитостей, блогерш, стримерш #СидимДома. 3’162 подписчиков 989 просмотров на пост. Telemetr.me Подписаться. Аналитика телеграм-каналов — обновления инструмента, новости рынка. Просмотр поста #1286 от 2020-04-05 16:58:17.   Кристина Финк. Медиафайл может содержать 18+ контент. Кликните, чтобы посмотреть. Изображение. Последние посты канала: Сливы и лайфстайл знаменитостей, блогерш, стримерш #СидимДома : 3’162 | на пост: 989 | ER: 31.3% Публикации Упоминания Аналитика 2020-06-08 19:48:41 | Показать пост. 263 0. Медиафайл может содержать 18+ контент. Кликните, чтобы посмотреть. Изображение.

Kristina Fink. Kristina Fink. Главная. Фидбэк. Контакты. Контакты. Кристина Финк. Основной стиль: Progressive House Любимые стили: Chillout, Deep House, Deep Techno, Disco House, Drum & Bass, Drumfunk, Electro, Electro House, Electro Progressive, Funky House, Hard House, Hard Trance, Hip-hop/Rap, House, Minimal Techno, Progressive Trance, R&B, Speed Garage, Tech House, Techno, Trance, Trip-Hop, Vocal House. Слушательница.

Частные и приватные фотографии пользователей с именем Финк Кристина, из города Москва. Поделиться. База частных фото и приватных фотографий пользователей из закрытых сообществ в ВКонтакте (вк, vk) Рады видеть вас на нашем сайте VK-Photo, который является самой большой базой частных фотографий социальной сети Вконтакте! Пользуясь нашей поисковой системой, вы сможете найти приватные фотографии своих друзей и подруг, а также просто любого пользователя социальной сети VKontakte, для этого вам потребуется либо ссылка на страницу этого человека, либо его ID, либо короткий адрес в ВК.

Кристина Финк. Подписчиков: 1251 Сообщений: 13 Рейтинг постов: 172.6. Nooon. Кристина Финк wtf песочница. Что за дела? Куда пропали все посты?  Тут лежат интересные картинки и комиксы по теме: Кристина Финк (+13 картинок, рейтинг 172.6 — Кристина Финк). Угадай число! Тебе надо выбрать любое целое число от 0 до 100.

Кристина Финк – молодая и очень привлекательная девушка. Она известна благодаря своим качественным и очень реалистичным косплеям. Среди ее любимых персонажей Цири из «Ведьмака», Наруто и Харли Квинн. Биография. Родилась Кристина Финк 19 января 1997 году во Владивостоке, Россия. В родном городе она окончила среднюю школу. С раннего детства Кристина начала увлекаться компьютерными играми и просмотром фильмов. Девочка представляла себя на месте понравившихся ей персонажей. И ей удалось связать с этим свою жизнь.  Также на своей страничке в Инстаграме, Кристина Финк постоянно выкладывает свои фото в различных, а иногда и откровенных образах.

Приобрела популярность в Instagram благодаря фотографиям с выражением лица под названием ахегао. Хаккеры решили сэкономить ваши деньги и показать слитые фотографии бесплатно и без регистрации! (Много фото). 50 не понравился. 10 понравился пост. Незарегистрированные посетители не могут оценивать посты. Понравился пост? Поделись с друзьями! Комментарии.

Цитокин и белок циклооксигеназы-2 в областях мозга мышей с опухолями и простаноидной анорексией

Реферат

Данные свидетельствуют о том, что цитокины в центральной нервной системе являются медиаторами анорексии у носителей опухоли. Поэтому с помощью иммуногистохимического анализа изображений мы оценили изменения интерлейкина (IL) -1β, IL-6, фактора некроза опухоли (TNF) α, рецептора IL-6 (gp130), рецептора I IL-1 и циклооксигеназы ( Cox) -2 в коре головного мозга, гиппокампе и вентромедиальном ядре гипоталамуса (VMH) у мышей с опухолью и простаноидной анорексией.В качестве контроля использовали мышей, получавших парное вскармливание, без опухолей. Простагландин E 2 систематически вводили свободно питающимся мышам, не несущим опухоли, чтобы подтвердить роль простаноидов в модуляции цитокинов мозга и потреблении пищи.

Динамика изменения IL-1β значительно различалась у мышей с опухолью и контрольных мышей, получавших парное вскармливание, в гиппокампе, но не в VMH. TNF-α в гиппокампе и VMH не показал каких-либо значительных различий между мышами с опухолями и контрольными мышами, получавшими парное питание, тогда как TNF-α показал небольшое увеличение с течением времени в VMH головного мозга.Содержание IL-6 не показало каких-либо значительных изменений среди мышей с опухолью и мышей, получавших парное питание, но значительно увеличивалось со временем как в исследуемой, так и в контрольной группе. Cox-2 в гиппокампе головного мозга и VMH показал статистически значимое повышение как в контрольной группе с опухолью, так и в контрольной группе, получавшей парное питание, без разницы между группами животных. Системное введение экзогенного PGE 2 мышам, не несущим опухоли, значительно изменило цитокины мозга в гиппокампе и VMH с соответствующими изменениями в потреблении пищи.Наши результаты показывают, что некоторые различия (IL-1β) имели место в цитокинах мозга при сравнении мышей с опухолью и мышей, получавших парное питание, но не несущих опухоль, но в пределах неожиданно пониженных уровней в ткани мозга мышей с опухолью. Удивительно, но многие временные изменения цитокинов мозга были аналогичным образом изменены у мышей с опухолью и мышей, получавших парное питание. Наши наблюдения не подтверждают, что повышенная регуляция цитокинов мозга объясняет или способствует анорексии при онкологическом заболевании. Скорее, цитокиновые и зависимые от Кокса изменения в ткани мозга, по-видимому, были вторичными по отношению к снижению потребления пищи и связаны с последующей активностью гормонов стресса.

ВВЕДЕНИЕ

Анорексия заметно ухудшает общую выживаемость пациентов и считается основным фактором окончательной смерти у 50% больных раком. (1 , 2) . Хотя периферически продуцируемые цитокины, особенно IL 4 -1β, TNF-α и IL-6 являются медиаторами кахексии. (3, 4, 5, 6, 7, 8, 9, 10, 11, 12) , есть косвенные доказательства того, что цитокины мозга также важны вместе с нейротрансмиттерами и нейротрофическими факторами в опосредовании анорексии при опухолевом заболевании.Сообщалось, что IL-1β вызывает анорексию после интрацеребровентрикулярных инъекций. (13, 14, 15, 16) , и положительная корреляция между потреблением пищи и концентрацией IL-1α в спинномозговой жидкости наблюдалась у крыс с аноректическими опухолями. (17) , тогда как инъекции антагониста рецептора IL-1 внутри VMH улучшили потребление пищи (17) . Соответственно, повышающая регуляция мРНК IL-1β в ткани мозга может быть значительным фактором анорексии у крыс с опухолями. (18) . В отличие от IL-1β, TNF-α и IL-6 оказывали лишь кратковременное аноректическое действие при интрацеребровентрикулярном введении, а толерантность развивалась после повторных инъекций. (19 , 20) .Аноректические эффекты IL-1 могут быть опосредованы простагландинами на основании наблюдения, что предварительное лечение ибупрофеном полностью блокировало аноректические эффекты IL-1. (21) . Цокс-2, индуцибельный ЦОГ, широко присутствует в тканях мозга и активируется в мозге грызунов в ответ на системное введение бактериального липополисахарида. (22 , 23) . Таким образом, экспрессия цитокинов и соответствующих рецепторов в связи с экспрессией Цокс-2 в различных областях мозга может иметь значение для развития и прогрессирования анорексии, индуцированной опухолью.Таким образом, в настоящем исследовании оценивались изменения во времени цитокинов мозга и Цокс-2 на модели опухоли с цитокиновой и простаноид-зависимой анорексией.

МАТЕРИАЛЫ И МЕТОДЫ

Экспериментальные процедуры.

Взрослые самки мышей C57BL / 6 (22–27 г; Bomholtgård, Дания), содержавшиеся группами по четыре-пять человек в пластиковых клетках, получали корм для лабораторных грызунов (ALAB AB; Стокгольм, Швеция) и воду из-под крана. ad libitum. За 14 дней до экспериментов в комнате с регулируемой температурой с 12-часовым циклом темнота / свет.Животных помещали на металлический пол для адаптации к условиям эксперимента за 3 дня до эксперимента.

Мыши с опухолями.

Шестьдесят три мыши были разделены на четыре группы с опухолью ( n = 21), контрольными животными без опухолей, получавшими парное питание ( n = 21), здоровыми контрольными мышами, не несущими опухоли ( n = 10) и исходные контроли ( n = 11). Под легкой анестезией (Ketalar, Rompun i.п.), мышам имплантировали подкожно. билатерально в боках в день 0 с помощью 3–5 мм 3 трансплантируемой саркомы, индуцированной метилхолантреном (MCG101). Контрольные мыши, получавшие парное вскармливание, подверглись фиктивной операции и их кормили парами в соответствии с потреблением пищи у мышей с опухолями со свободным доступом к водопроводной воде, как описано (24) . Здоровых контрольных мышей, которых бесплатно кормили, содержали в тех же условиях, что и мышей с опухолями, но им давали свободный доступ к корму для лабораторных грызунов и водопроводной воде. Ежедневный прием пищи и масса тела регистрировались с 8:00 до 18:00.м. и 9:00 утра. Одиннадцать мышей из базовой контрольной группы были убиты через 3 дня после помещения на проволочный пол для определения значений цитокинов, gp130, IL-1RI и Cox-2 в день 0 в иммуногистохимическом анализе изображений. Мышей с опухолями и мышей, получавших парное вскармливание, умерщвляли в подгруппах по семь человек на 4, 7 и 14 дни. Образцы крови получали путем пункции сердца после анестезии. Мозг немедленно фиксировали in situ, перфузией. Сосудистое русло промывали 20 мл физиологического раствора через левый желудочек сердца с последующей перфузией 20 мл 4% параформальдегида в фосфатном буфере (pH 7.4). Мозг быстро извлекали и фиксировали в забуференном 4% параформальдегиде при комнатной температуре в течение 20–24 ч после перфузии и фиксации in situ и . Образцы залили парафином и разрезали на срезы размером 8 мкм для иммуногистохимического окрашивания. Срезы были распределены между интерауральной линией 2,46 и 1,86 мм, брегмой -1,34 и -1,94 мм, согласно Мозгу мыши в стереотаксических координатах. (25) . VMH проверяли окрашиванием гематоксилином Райта под микроскопом.

PGE

2 Обеспечение мышей без опухолей.

Мыши, не несущие опухоли, получили микроосмотический насос (ALZET 1007D), помещенный в брюшную полость. Насос выпустил PGE 2 (высокая доза, 1872 мкг / 100 мкл, n = 13; или низкая доза, 312 мкг / 100 мкл, n = 4) или носитель ( n = 13) в течение расход 0,5 мкл / ч. Прием пищи и вес тела регистрировались ежедневно с 8:00 до 9:00. (24) . На 7 день образцы крови и головной мозг обрабатывали, как описано выше, для определения PGE 2 , а также IL-6 в крови и иммуногистохимического определения цитокинов и экспрессии Cox-2 в ткани мозга (по четыре мыши в каждой подгруппе).Животных умерщвляли в дни 0, 2, 4 и 7 для определения содержания PGE 2 и IL-6 в крови, как описано ниже. Цитокины головного мозга и анализ ЦОГ-2 выполняли, как описано для мышей с опухолью.

Иммуногистохимическое окрашивание.

Протоколы иммуногистохимического окрашивания были оптимизированы. Первичные антитела разводили в 1% TBS-BSA, содержащем 0,1% сапонина, в 1:10 моноклональном крысином антимышином IL-6 (PharMingen 18082D), моноклональном крысином антимышином TNF-α (PharMingen 18131D), моноклональном крысином антимышином IL-1RI (Serotec MCA1760Z). , 1:40 мультиклональный козий антимышиный IL-1β (R&D AF-401-NA), поликлональный кроличий анти-IL-6Rα (gp130; крыса / мышь; Research Diagnostics RDI-RTILRAabr) и 1: 100 поликлональный козий антимышиный COX-2 (Santa Cruz Biotechnology 1746) и инкубировали в течение ночи (20 ч) при комнатной температуре после блокирования неспецифического связывания 5% BSA.В качестве вторичных антител использовали биотинилированные кроличьи антитела против IgG кроликов (Dako E0468), биотинилированные кроличьи антитела против козьих IgG (Dako E0466) и биотинилированные свиньи против кроличьих IgG (Dako E0353), разбавленные в 1% TBS-BSA с 0,1% сапонина 1: 300 и нейтрализованные. с нормальной мышиной сывороткой 1:10 в течение не менее 4 часов при 4 ° C перед использованием. Вторичное антитело инкубировали 30 мин при комнатной температуре. StreptABComplex / AP (Dako K0391) использовали в качестве проявляющей системы, а 5-бром-4-хлор-3-индолилфосфат / нитросиний тетразолий (Dako K0598) использовали в качестве субстрата.Все инкубации и промывки обрабатывали в присутствии 0,1% сапонина в TBS. Отрицательный контроль представлял собой нормальную сыворотку или IgG того же вида, что и первичные антитела.

Иммуногистохимический анализ изображений.

Экспрессия

IL-1β, TNF-α, IL-6, IL-6Rα (gp130), IL-1RI и Cox-2 была исследована в гиппокампе мозга и области VMH с помощью иммуногистохимического анализа изображений. Область гиппокампа включала поля СА1, СА2 и СА3. Пятнадцать полей были сняты при усилении × 40 вдоль пирамидального слоя.Зубчатая извилина в анализ не включалась. Представляющую интерес область VMH определяли окрашиванием гематоксилином Райта в последовательном срезе, а иммуноокрашенные срезы анализировали при амплификации × 10.

Окрашенные срезы считывали под световой микроскопией (Nikon E400), и 15 снимков гиппокампа получали в каждом срезе с увеличением × 40 цветной видеокамерой Sony (SSC CD18P) и сохраняли в виде файлов Tiff. Анализ изображений выполнялся на компьютере Macintosh с использованием общедоступной программы изображений NIH (V1.61 / жир). 5 После пространственной калибровки полутоновая шкала 61 использовалась в качестве порога при вычислении положительной области. Положительная площадь выражалась в процентах от общей площади поля (положительная площадь%) на микрофотографии с качеством, показанным на рис. ⇓ . Изменение содержания цитокинов gp130, IL-1RI и Cox-2 в мозге с течением времени выражали как относительное изменение по сравнению с измерениями на мышах, представленными значениями дня 0:

Рис.1.

Микрофотографии окрашивания гематоксилином и иммуноокрашивания IL-1β, TNF-α, IL-6, gp130, IL-RI и Cox-2 по сравнению с отрицательным контролем в VMH.StreptABComplex / AP использовали в качестве проявляющей системы, а 5-бром-4-хлор-3-индолилфосфат / нитросиний тетразолий — в качестве субстрата. × 40.

Биохимические анализы крови.

PGE 2 определений выполняли с помощью системы анализа PGE 2 (I125) RIA (Amersham RPA 530) в течение 6 дней после эксперимента в дубликатах, как описано (26) . Систему ELISA на мышиный IL-6 использовали для анализа плазменного IL-6 (Amersham RPN 2714).Предел обнаружения составил 25 пг / мл. (27) .

Статистика.

Результаты представлены как среднее ± стандартная ошибка. Временные изменения потребления пищи, веса туши и цитокинов головного мозга среди групп животных сравнивали с использованием двухфакторного дисперсионного анализа для повторных измерений. Статистика представлена ​​для различий между группами, изменений во времени и для взаимодействий между группой и временем. P ≤ 0,05 считалось статистически значимым, а P <0.10 считалось тенденцией к значимости. Корреляцию между PGE 2 и массой опухоли рассчитывали методом рангов Спирмена.

РЕЗУЛЬТАТЫ

Опухолевые эксперименты.

PGE в плазме 2 увеличивался экспоненциально с положительной корреляцией с ростом опухоли ( r = 0,98), тогда как PGE в плазме 2 оставался в низкой концентрации (от 98 до 380 пг / мл) на протяжении всего экспериментального периода при парном вскармливании. элементы управления (рис.2) ⇓ . Потребление пищи и вес туши начали значительно снижаться на 7-й день у мышей с опухолями (рис. 3). ⇓ ; P <0,01). Было технически возможно кормить паром мышей, не несущих опухоль, что соответствовало потреблению пищи мышей с опухолью, которое оказалось на 1 г / мышь / день меньше, чем потребляемая пища мышами, не несущими опухоль, на свободном питании. Вес туши мышей, получавших парное вскармливание, не уменьшился статистически значимо, что подтверждено для животных с опухолями (рис. 3). ⇓ , как было замечено в наших предыдущих выводах (24 , 28, 29, 30, 31, 32, 33) .

Рис.2.

PGE 2 концентрации в плазме мышей с опухолью и мышей, получавших парное питание, и взаимосвязь между плазменным PGE 2 и массой опухоли у мышей с опухолью. Барс , SE.

Рис. 3.

Потребление пищи и вес туши мышей с опухолью и мышей, получавших попарное питание, по сравнению с контрольными мышами, получавшими свободный корм (потребление пищи: между группами, P <0,01; с течением времени, P, <0,01; взаимодействие между группой и временем, P <0.01; Масса тушки: между группами P = 0,45; сверхурочные, P <0,01; взаимодействие между группой и временем, P <0,01; по семь животных в каждой точке наблюдения). Барс , SE.

Временные изменения IL-1β значительно различались у мышей с опухолью и контрольных мышей, получавших парное питание, в гиппокампе, но не в VMH, тогда как изменения IL-1β с течением времени были статистически значимыми в гиппокампе и пограничной значимостью в VMH.Взаимодействие между группой и временем для IL-1β было статистически значимым в гиппокампе, но не в VMH (рис. 4). ⇓ . TNF-α в гиппокампе головного мозга и VMH не показали каких-либо значительных различий между мышами с опухолью и контрольной группой, получавшей парное питание, тогда как изменения TNF-α с течением времени показали значительное увеличение VMH (рис. 5). ⇓ . Содержание IL-6 в гиппокампе мозга и VMH не отличалось между мышами с опухолью и контрольной группой, получавшей парное питание, но, по-видимому, со временем наблюдалось увеличение VMH, по крайней мере, у мышей с опухолью (рис.6) ⇓ .

Рис.4.

Временные изменения IL-1β в гиппокампе головного мозга и VMH мышей с опухолями и контрольной группы, получавшей парное питание (гиппокамп: между группами, P <0,01; с течением времени, P <0,01; взаимодействие между группой и временем , P <0,01; VMH: между группами, P = 0,41; с течением времени, P = 0,09; взаимодействие между группой и временем, P = 0,29; семь животных в каждой точке наблюдения). Барс , SE.

Рис. 5.

Динамика изменения TNF-α в гиппокампе головного мозга и VMH мышей с опухолью и контрольной группы, получавшей парное питание (гиппокамп: между группами, P = 0,65; с течением времени, P = 0,73; взаимодействие между группой и временем, P = 0,93; VMH: между группами, P = 0,44; со временем, P <0,01; взаимодействие между группой и временем, P = 0,45; семь животных в каждой точке наблюдения). Барс , SE.

Рис. 6.

Временные изменения IL-6 в гиппокампе головного мозга и VMH мышей с опухолями и контрольных мышей, получавших парное питание (гиппокамп: между группами, P = 0,72; с течением времени, P = 0,86; взаимодействие между группой и временем , P = 0,87; VMH: между группами, P = 0,44; с течением времени, P = 0,01; взаимодействие между группой и временем, P = 0,47; по семь животных в каждой точке наблюдения). Барс , SE.

Оценка экспрессии в головном мозге VMH gp130 (рецептор IL-6 α) и IL-1RI представлена ​​на рис. ⇓ . Не было значительных различий между мышами, несущими опухоль, и контрольными мышами, получавшими парное вскармливание, для gp130 и IL-1RI ни в одном из наблюдаемых аспектов. Напротив, Cox-2 значительно увеличивался с течением времени в гиппокампе мозга и VMH как мышей с опухолью, так и мышей, получавших парное питание, без каких-либо различий между группами (рис. 8). ⇓ .

Рис.7.

Временные изменения gp130 и IL-1RI в VMH головного мозга мышей с опухолью и контрольных мышей, получавших парное питание (gp130: между группами, P = 0.56; со временем P = 0,30; взаимодействие между группой и временем, P = 0,48; IL-1RI: между группами, P = 0,73; со временем P = 0,52; взаимодействие между группой и временем, P = 0,37; по семь животных в каждой точке наблюдения). Барс , SE.

Рис. 8.

Временные изменения Cox-2 в гиппокампе мозга и VMH мышей с опухолью и контрольных мышей, получавших парное питание (гиппокамп: между группами, P = 0.54; со временем P <0,01; взаимодействие между группой и временем, P = 0,34; VMH: между группами, P = 0,23; со временем P = 0,01; взаимодействие между группой и временем, P = 0,08; по семь животных в каждой точке наблюдения). Барс , SE.

и.п. Предоставление PGE

2 мышам без опухолей.

Анестезия и хирургическая имплантация i.p. микроосмотический насос для i.п. Предоставление PGE 2 вызывало выраженное снижение потребления пищи в течение 1 дня после экспериментальных процедур у нормальных мышей (рис.9) ⇓ . Однако восстановление приема пищи было значительно более быстрым в фиктивной контрольной группе по сравнению с восстановлением в группах исследования, получавших либо высокую, либо низкую дозу PGE 2 . Все различия в потреблении пищи с течением времени были статистически значимыми ( P <0,01), а также взаимодействие между группой и временем ( P <0.01). Соответственно, изменения массы тела статистически различались между исследованием и фиктивной группой, что также подтверждалось изменениями массы тела с течением времени ( P <0,01) и взаимодействием между группой и временем ( P <0,01; Рис. 9 ⇓ ). Мышей без опухолей, получавших высокую дозу PGE 2 , также использовали для оценки изменений во времени содержания цитокинов головного мозга (IL-1β и TNF-α) в коре головного мозга, гиппокампе и VMH (рис. 10) ⇓ . Результаты продемонстрировали, что IL-1β показал статистически значимое изменение во времени в коре головного мозга и VMH с тенденцией к разнице между исследуемой и фиктивной группами при VMH.TNF-α показал значительную разницу только в коре головного мозга между исследованной и фиктивной группой, тогда как изменения с течением времени значительно изменились как в области гиппокампа, так и в области VMH.

Рис.9.

Изменения приема пищи и массы тела после внутрибрюшинного введения. Обеспечение PGE 2 микроосмотическим насосом у мышей, которых свободно кормили (потребление пищи: между группами, P <0,01; с течением времени, P <0,01; взаимодействие между группой и временем, P <0,01; тело вес: между группами, P <0.08; со временем P <0,01; взаимодействие между группой и временем, P <0,01). Барс , SE. Обеспечение высокой дозой PGE 2 соответствовало 220–240 мкг / мышь / день, а низкая доза соответствовала 35–45 мкг / мышь / день (от четырех до семи наблюдений в каждой точке).

Рис. F10-1106.

Временные изменения IL-1β ( левая панель, ) и TNF-α ( правая панель ) в коре головного мозга, гиппокампе и VMH мышей, получавших PGE 2 .Для IL-1β: (кора головного мозга: с течением времени, P <0,05; VMH: между группами, P <0,07; с течением времени, P <0,01; взаимодействие между группой и временем, P <0,01). Для TNF-α: (кора головного мозга: между группами, P <0,05; взаимодействие между группой и временем, P <0,05; гиппокамп: с течением времени, P <0,01; взаимодействие между группой и временем, P < 0,02; VMH: с течением времени, P <0,02; взаимодействие между группой и временем, P <0.06). Было сделано минимум три наблюдения в каждой точке. Барс , SE.

ОБСУЖДЕНИЕ

Понимание механизма раковой кахексии улучшилось за последние годы, что отчасти связано с использованием четко определенных экспериментальных моделей животных с опухолями. Накапливающиеся данные подтверждают концепцию, что как системные цитокины, так и цитокины, происходящие из ЦНС, являются медиаторами анорексии-кахексии. (3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20) .В дополнение к таким наблюдениям также предполагалось, что простаноиды участвуют в качестве вторичных медиаторов для более известных пептидов цитокинов и классических факторов роста. (21 , 34 , 35) . Однако остается неясным, является ли кахексия основной причиной или следствием анорексии. Эксперименты с парным кормлением, связанные с приемом пищи на мышах с опухолями, на самом деле выявили несколько опухолеспецифических изменений метаболизма хозяина. (24 , 28 , 31 , 36, 37, 38, 39) . Следовательно, даже на животных моделях было трудно оценить, в какой степени анорексия на самом деле представляет собой адаптацию в приеме пищи, вторичную по отношению к ремоделированию компартментов хозяина в ответ на рост опухоли.Эта неопределенность особенно актуальна для ситуации с пациентом. (40) , но аналогичные неопределенности также действительны в большинстве моделей опухолей. Однако в некоторых моделях животных сообщалось, что отходы туши происходят независимо от анорексии. (41) . Следовательно, нельзя полностью исключить, что анорексия является независимым и первичным изменением, которое объясняет кахексию рака, по крайней мере, в определенные периоды прогрессирования опухоли. (42) . Независимо от того, что является первичным или вторичным изменением контроля аппетита, важно понимать регулирующие механизмы, лежащие в основе контроля ЦНС за приемом пищи.Поэтому мы оценили динамику изменения содержания цитокинов в мозге (IL-1β, IL-6, TNFα, IL-6Rα, IL-1RI и Cox-2) в гиппокампе и ядре VMH от инбредных мышей C57 bl подкожно. с имплантированной опухолью (MCG101), способствующей анорексии / кахексии, связанной с цитокинами и простаноидами. Эта модель опухоли была подробно охарактеризована метаболически, и изменения опухоль-хозяин в нескольких аспектах аналогичны метаболическим изменениям, наблюдаемым у невыбранных пациентов с онкологическими заболеваниями, снижающих вес. (43) . Мы обнаружили, что потеря веса туши мышей с опухолями тесно связана с изменениями в приеме пищи, которые все ослабляются ингибированием циклооксигеназы. (26 , 35 , 44) .Парное вскармливание и парно-взвешенные эксперименты на мышах, не несущих опухоли, показали, что большинство наблюдаемых изменений опухоль-хозяин может быть имитировано первичным снижением потребления пищи (адаптация к голоданию; ссылки. 24 и 45 ), хотя наблюдались некоторые различия, которые могут быть связаны с опухолью. (36) . Например, расход энергии в состоянии покоя у наших мышей с опухолью показывал другой суточный ритм по сравнению с метаболизмом у мышей, лишенных полноценного питания, без опухолей. (30) .Кроме того, большинство метаболических изменений, связанных с опухолью, может быть спровоцировано внутрибрюшинным введением. или п. инъекция бактериальных антигенов, экстрагированных из Corynebacterium parvum (46, 47, 48) . Мы также сообщали, что несколько классических изменений, связанных с опухолью и хозяином, тесно связаны с хорошо известными стрессовыми изменениями в осях гипофиза / надпочечников. (33 , 49 , 50) . Например, системные воспалительные реакции в ответ на рост злокачественной опухоли сильно зависели от наличия надпочечников у мышей. (33 , 50) .Таким образом, наша предыдущая работа ясно демонстрирует, что метаболизм опухоль-хозяин может быть вторичным по отношению к первичному снижению потребления пищи, частично опосредованному цитокинами, простаноидами и классическими гормонами стресса, которые все вносят вторичные изменения в энергетический обмен и чувствительность к гормонам.

На основе вышеупомянутых доказательств мы теперь оценили, в какой степени цитокины мозга мышей с опухолью по-разному связаны с цитокинами мозга у мышей, получавших парное питание, не несущих опухоль.Таким образом, экспериментальный подход аналогичен нашим предыдущим исследованиям метаболических изменений в печени и периферических тканях мышей, несущих MCG101. (24) . Результаты настоящего исследования подтверждают наши предыдущие выводы о том, что анорексия становится значительной через 6-7 дней после имплантации опухоли и что вес туши, вероятно, начинает снижаться несколько раньше, чем потребление пищи мышами, несущими MCG101. (38) . Эти неоднократно наблюдаемые изменения предполагают, что начальный рост опухоли может в достаточной степени поддерживаться перераспределением метаболических соединений (субстрата и энергии) внутри организма-хозяина без введения строго параллельного ослабления приема пищи.Таким образом, вероятно, что анорексия становится очевидной, когда опухолевый компартмент достигает определенной метаболической доли от всего хозяина. Соответственно, до сих пор трудно судить, что является основной причиной анорексии, факторами, связанными с опухолью, или адаптацией к начальному изменению основного энергетического метаболизма с изменениями гормона стресса. Однако четкое различие между состоянием опухоль-хозяин и в чистом состоянии недокармливания (мыши, получавшие парное питание) — это наблюдаемое увеличение уровня PGE 2 в плазме мышей с опухолью, которое сильно коррелирует с опухолевой нагрузкой (рис. .2) ⇓ . Этот факт подчеркивает, что состояние прогрессирующего недоедания у носителей опухолей является смешанным состоянием как с системным воспалением, так и с чистым недоеданием.

Наши настоящие эксперименты были разработаны для оценки изменений во времени пептидов мозга, выраженных как относительное изменение по сравнению с исходными уровнями в мозге свободно питающихся, хорошо адаптированных, не несущих опухоль мышей (день 0, 100%). Однако количественная оценка иммуно-гистохимических изменений обычно подвергается сравнительно высокой степени вариации, особенно при проведении на разных группах животных.Также возможны межвыборочные вариации. Поэтому мы сосредоточились на статистической модели с оценкой изменений за весь экспериментальный период, с основным акцентом на различиях между исследуемыми и контрольными мышами. Такой подход может снизить возможность выявления или подтверждения небольших, но статистически значимых различий между опухолью и контрольной группой. С другой стороны, наш подход также снизит риск излишней интерпретации предполагаемых изменений, появляющихся случайно.Чтобы компенсировать сравнительно низкую чувствительность статистического анализа путем сравнения повторных образцов в течение 2-недельного периода среди исследуемых и контрольных мышей, мы также указали статистические тенденции, а также значительные взаимодействия между группами животных и время наблюдения во время экспериментов. Было сделано несколько интересных наблюдений. ИЛ-1β был единственным цитокином со статистически значимой разницей между контролем с опухолью и парным кормлением в любой из оцениваемых областей мозга (гиппокамп), но с неожиданно низкими уровнями у мышей с опухолью.TNF-α не показал различий между группами, без каких-либо заметных изменений с течением времени. Также ИЛ-6, который ранее был идентифицирован как важный цитокин, стоящий за изменениями метаболизма периферических тканей у животных с опухолями. (27) , не показали каких-либо различий между группами, тогда как со временем наблюдалось значительное увеличение VMH, по крайней мере, у мышей с опухолями. Наши результаты свидетельствуют о том, что метаболизм цитокинов в головном мозге кажется более сложным, чем взаимосвязь, о которой сообщалось в других тканях животных с опухолями, где нередко наблюдается положительная и пропорционально увеличенная взаимосвязь между повышенной активностью цитокинов и измененным метаболизмом опухоль-хозяин. (51) .Отсутствие сравнительно выраженных изменений цитокинов мозга в настоящем исследовании, вероятно, не объяснялось различиями на соответствующих уровнях рецепторов, поскольку не было обнаружено никаких изменений в gp130 (рецептор IL-6 α) и IL-1RI. Однако Cox-2 увеличивался в гиппокампе как у несущих опухоль, так и у контрольных групп, получавших парное питание, с аналогичной картиной в VMH головного мозга. Таким образом, наши результаты не согласуются с выводами, основанными на опубликованных ранее наблюдениях о том, что антагонисты рецептора IL-1 улучшают потребление пищи у животных с аноректическими опухолями. (17) .

Для дальнейшей оценки наших предыдущих предложений о взаимосвязи между активностью простаноидов и метаболизмом опухоль-хозяин был предоставлен PGE 2 с помощью i.p. микроосмотический насос у мышей без опухолей. Эти эксперименты подтвердили, что хорошо адаптированные мыши очень чувствительны к стрессовым реакциям, таким как анестезия и хирургические манипуляции, о чем свидетельствует начальное снижение потребления пищи такими животными до 10% (рис.9). ⇓ . Однако потребление пищи восстанавливалось быстрее всего у контрольных животных, которым вводили ложную инъекцию, по сравнению с мышами, получавшими PGE 2 .Эти эксперименты не могут представлять или моделировать точно настроенную физиологическую ситуацию, но отражают ожидаемые выводы о том, что системное обеспечение PGE 2 может быть преобразовано во влияние на потребление пищи с последующими изменениями массы тела, и согласуются с выводами о том, что изменения в кормлении могут быть связаны с Экспрессия Cox-2 в головном мозге. Более того, эти краткосрочные, но согласованные данные были связаны со значительными изменениями IL-1β и TNF-α в коре головного мозга, гиппокампе и VMH (рис.10) ⇓ . В настоящее время результаты этих упрощенных экспериментов с экзогенным обеспечением PGE 2 не могут быть интерпретированы физиологически значимым образом, но демонстрируют возможную связь между метаболизмом простаноидов за пределами мозгового барьера и экспрессией цитокинов внутри ЦНС. Таким образом, цитокины могут не только контролировать выработку простаноидов в целом, но и простаноиды системного происхождения, возможно, также могут контролировать или, по крайней мере, влиять на выработку цитокинов в головном мозге. (52) . Также возможно, что изменения продукции цитокинов вне ЦНС могут транслироваться в изменения Цокс-2 внутри ЦНС (рис.8) ⇓ . Такое двунаправленное взаимодействие простаноидов и цитокинов через гематоэнцефалический барьер отражает сложную ситуацию между метаболическими каскадами в тканях и ЦНС. (53) .

Общее впечатление от нашего настоящего исследования состоит в том, что мало различий в цитокинах мозга в опухолевом состоянии с истощением организма хозяина по сравнению с состоянием с чистым недоеданием. Таким образом, многие направленные изменения цитокинов мозга были аналогичным образом изменены у мышей с опухолью и мышей, получавших парное питание.Эти наблюдения не подтверждают, что повышающая регуляция цитокинов мозга играет важную роль в возникновении и продвижении анорексии у мышей с опухолями. Скорее, цитокиновые и зависимые от Кокса изменения, по-видимому, были вторичными по отношению к снижению потребления пищи и могут представлять адаптацию к секреции гормона стресса, вызванную частичным голоданием у мышей с опухолью и мышей, получавших парное питание.

Сноски

  • Расходы на публикацию этой статьи были частично покрыты за счет оплаты страницы.Таким образом, данная статья должна быть помечена как реклама в соответствии с 18 U.S.C. Раздел 1734 исключительно для указания этого факта.

  • №1 Частично поддержан грантами 2014, 01PAA и 4261 Шведского онкологического общества; Гранты 08712, 13159 и 13268 Шведского совета медицинских исследований; и гранты от Фонда Торе Нильсона, Фонда Ассара Габриэльсона (AB Volvo), Фонда Юбилеумсклиникен, Исследовательского фонда ИнгиБритт и Арне Лундберг, Фонда Кнута и Алисы Валленберг, Шведского и Гетеборгского медицинских обществ, а также медицинского факультета Гетеборгского университета. .

  • ↵2 Нынешний адрес: Serono International, Женева, Швейцария.

  • №3 Кому следует обращаться с просьбами о перепечатке, в хирургическом отделении больницы Салгренского университета, S-413 45 Гетеборг, Швеция. Телефон: 46-31-342-2239; Факс: 46-31-82-65-39; Эл. Почта: Kent.Lundholm Surgery.gu.se

  • ↵4 Используемые сокращения: IL, интерлейкин; IL-1RI, рецептор IL-1 I; TNF, фактор некроза опухоли; ВМГ, вентромедиальный гипоталамус; Кокс, циклооксигеназа; PGE 2 , простагландин E 2 ; ЦНС, центральная нервная система.

  • №5 Адрес в Интернете: http://rsb.info.nih.gov/nih-image/.

  • Получено 13 марта 2000 г.
  • Принято 13 апреля 2001 г.
  • © 2001 Американская ассоциация исследований рака.

Каталожные номера

  1. Лоусон Д. Х., Ричмонд А., Никсон Д. В., Рудман Д. Метаболические подходы к раковой кахексии. Анну. Rev. Nutr., 2 : 277-301, г. 1982 г.

  2. Никсон Д. В., Хеймсфилд С. Б., Коэн А. Э., Катнер М. Х., Ансли Дж., Лоусон Д. Х., Рудман Д. Белково-калорийное недоедание у госпитализированных онкологических больных. Являюсь. J. Med., 68 : 683-690, 1980.

  3. Молдавер Л. Л., Джорджифф М., Лундхольм К. Интерлейкин 1, фактор некроза опухоли-α (кахектин) и патогенез раковой кахексии. Clin. Physiol., 7 : 263-274, 1987 г.

  4. Стоврофф М.С., Фракер Д. Л., Сведенборг Дж. А., Нортон Дж. А. Кахектин / фактор некроза опухоли: возможный медиатор анорексии рака у крыс. Cancer Res., 48 : 4567-4572, г. 1988.

  5. Шерри Б. А., Гелин Дж., Фонг Ю., Марано М., Вей Х., Керами А., Лоури С. Ф., Лундхольм К. Г., Молдавер Л. Л. Антитела к антикахектину / фактору некроза опухоли α ослабляют развитие кахексии на моделях опухолей.FASEB J., 3 : 1956-1962, 1989.

  6. Гелин Дж., Молдавер Л. Л., Лоннрот К., Шерри Б., Чиззонит Р., Лундхольм К. Роль эндогенного фактора некроза опухоли α и интерлейкина 1 в экспериментальном росте опухоли и развитии раковой кахексии. Cancer Res., 51 : 415-421, г. 1991.

  7. Strassmann G., Kambayashi T. Ингибирование экспериментальной раковой кахексии с помощью антицитокиновой и антицитокиновой рецепторной терапии.Cytokines Mol. Ther., 1 : 107-113, 1995.

  8. Смит Б. К., Клюгер М. Дж. Антитела против TNF-α нормализовали температуру тела и увеличивали потребление пищи у крыс с опухолями. Являюсь. J. Physiol., 265 : R615-R619, 1993.

  9. Макинтош Дж. К., Яблонс Д. М., Мул Дж. Дж., Нордан Р. П., Рудикофф С., Лотце М. Т., Розенберг С. А. Индукция in vivo IL-6 путем введения экзогенных цитокинов и обнаружения de novo уровней IL-6 в сыворотке у мышей с опухолями.J. Immunol., 143 : 162–167, 1989.

  10. Gelin J., Moldawer L. L., Lonnroth C., de Man P., Svanborg-Eden C., Lowry S. F., Lundholm K. G. Появление фактора роста гибридомы / интерлейкина-6 в сыворотке мышей с саркомой, вызванной метилхолантреном. Biochem. Биофиз. Res. Commun., 157 : 575-579, г. 1988.

  11. Блэк К., Гаррет И. Р., Манди Г.R. Клетки яичников китайского хомячка, трансфицированные геном интерлейкина-6 мыши , вызывают гиперкальциемию, а также кахексию, лейкоцитоз и тромбоцитоз у голых мышей с опухолями. Эндокринология, 128 : 2657-2659, г. 1991.

  12. Greenberg AS, Nordan RP, McIntosh J., Calvo JC, Scow RO, Jablons D. Интерлейкин 6 снижает активность липопротеинлипазы в жировой ткани мышей in vivo, и в адипоцитах 3T3 – L1: возможная роль интерлейкина 6 в раковая кахексия.Cancer Res., 52 : 4113-4116, г. 1992.

  13. Плата-Саламан К.Р. Режимы питания в ответ на внутрицеребровентрикулярное введение интерлейкина-1β у крыс. Physiol. Behav., 55 : 727-733, 1994.

  14. Hill A. G., Jacobson L., Gonzalez J., Rounds J., Majzoub J. A., Wilmore D. W. Хроническое воздействие интерлейкина-1β на центральную нервную систему вызывает катаболизм у крыс.Являюсь. J. Physiol., 271 : R1142-R1148, 1996.

  15. Финк Б. Н., Джонсон Р. В. Анорексия, потеря веса и повышение уровня интерлейкина-6 в плазме, вызванные хронической внутрицеребровентрикулярной инфузией интерлейкина-1β у крыс. Brain Res., 761 : 333-337, г. 1997.

  16. Плата-Саламан К. Р., Сонти Г., Боркоски Дж. П., Уилсон К. Д., Френч-Маллен Дж. М. б. u. е.Анорексия, вызванная хроническим центральным введением цитокинов в предполагаемых патофизиологических концентрациях. Physiol. Behav., 60 : 867-875, 1996.

  17. Опара Э. И., Лавиано А., Мегид М. М., Янг З. Дж. Корреляция между потреблением пищи и ИЛ-1α в спинномозговой жидкости у крыс с аноректической опухолью. Нейроотчет, 6 : 750-752, г. 1995.

  18. Плата-Саламан К. Р., Ильин С.Е., Гейл Д. МРНК цитокинов головного мозга у аноректических крыс, несущих опухолевые клетки аденокарциномы простаты. Являюсь. J. Physiol., 275 : R566-R573, 1998.

  19. Плата-Саламан К.Р. Анорексия, вызванная активаторами сигнального преобразователя gp 130. Нейроотчет, 7 : 841-844, 1996.

  20. Плата-Саламан К. Р., Васселли Дж. Р., Сонти Г. Дифференциальная реакция тучных ( fa / fa ) и худых ( Fa / Fa ) крыс Zucker на цитокин-индуцированную анорексию.Ожирение. Res., 5 : 36-42, 1997.

  21. Хеллерштейн М. К., Мейдани С. Н., Мейдани М., Ву К., Динарелло С. А. Интерлейкин-1-индуцированная анорексия у крыс. Влияние простагландинов. J. Clin. Исследование., 84 : 228-235, 1989.

  22. Бредер К. Д., Девитт Д., Крейг Р. П. Характеристика индуцибельной циклооксигеназы в головном мозге крысы. J. Comp. Neurol., 355 : 296-315, 1995 г.

  23. Бредер К. Д., Сапер С. Б. Экспрессия мРНК индуцибельной циклооксигеназы в мозге мышей после системного введения бактериального липополисахарида. Brain Res., 713 : 64-69, 1996.

  24. Lundholm K., Karlberg I., Ekman L., Edstrom S., Schersten T. Оценка анорексии как причины нарушения синтеза белка в скелетных мышцах у нерастущих мышей с саркомой.Cancer Res., 41 : 1989–1996, 1981.

  25. Франклин К. Б. Дж., Паксинос Г. Академик Пресс Нью-Йорк 1997.

  26. Lönnroth C., Svaninger G., Gelin J., Cahlin C., Iresjö B.-M., Cvetkovska E., Edström S., Svanberg E., Lundholm K. Эффекты, связанные с увеличением выживаемости индометацином и снижением роста опухоли в модели опухоли мышей с цитокин-зависимой раковой кахексией.Int. J. Oncol., 7 : 1404-1413, г. 1995.

  27. Lönnroth C., Gelin J., Lundholm K. Экспрессия интерлейкина-6 у несущих опухоль мышей с цитокинзависимой кахексией. Int. J. Oncol., 5 : 329-336, г. 1994.

  28. Сванингер Г., Лундберг П. А., Лундхольм К. Гормоны щитовидной железы и экспериментальная раковая кахексия. J. Natl. Онкологический институт, 77 : 555-561, 1986 г.

  29. Иден Э., Линдмарк Л., Карлберг И., Лундхольм К. Роль липидов и азота всего тела как ограничивающих факторов выживания мышей с опухолями, страдающих анорексией и кахексией. Cancer Res., 43 : 3707-3711, г. 1983.

  30. Линдмарк Л., Эдстром С., Экман Л., Карлберг И., Лундхольм К. Энергетический метаболизм у нерастущих мышей с саркомой. Cancer Res., 43 : 3649-3654, г. 1983 г.

  31. Сванингер Г., Беннегард К., Экман Л., Тернелл М., Лундхольм К. Отсутствие доказательств повышенной скорости разрушения скелетных мышц у худеющих мышей с опухолями. J. Natl. Онкологический институт, 71 : 341-346, г. 1983.

  32. Карлберг И., Экман Л., Эдстром С., Шерстен Т., Лундхольм К. Повторное использование аминокислотных атомов углерода в связи с обменом альбумина у мышей с саркомой, которые не растут.Cancer Res., 42 : 2284-2288, г. 1982.

  33. Гелин Дж. Л., Молдавер Л. Л., Иресьо Б. М., Лундхольм К. Г. Роль надпочечников в реакции острой фазы на интерлейкин-1 и фактор некроза опухоли-α. J. Surg. Res., 54 : 70-78, 1993.

  34. Lundholm K., Gelin J., Hyltander A., ​​Lonnroth C., Sandstrom R., Svaninger G., Korner U., Gulich M., Karrefors I., Norli B., et al. Противовоспалительное лечение может продлить выживаемость у истощенных пациентов с метастатическими солидными опухолями. Cancer Res., 54 : 5602-5606, г. 1994.

  35. Сандстром Р., Гелин Дж., Лундхольм К. Влияние индометацина на потребление пищи и воды, двигательную активность и выживаемость у крыс с опухолями. Евро. J. Рак, 26 : 811-814, 1990.

  36. Лундхольм К., Экман Л., Карлберг И., Эдстром С., Шерстен Т. Сравнение активности печеночного катепсина D в ответ на рост опухоли и ограничение калорийности у мышей. Cancer Res., 40 : 1680–1685, г. 1980.

  37. Экман Л., Карлберг И., Эдстром С., Линдмарк Л., Шерстен Т., Лундхольм К. Метаболические изменения в печени, скелетных мышцах и жировой ткани в ответ на различную опухолевую нагрузку у растущих крыс с саркомой. J. Surg. Res., 33 : 23-31, 1982.

  38. Лундхольм К., Эдстром С., Карлберг И., Экман Л., Шерстен Т. Взаимосвязь потребления пищи, состава тела и роста опухоли с метаболизмом хозяина у нерастущих мышей с саркомой. Cancer Res., 40 : 2516-2522, г. 1980.

  39. Сванингер Г., Дротт К., Лундхольм К. Роль инсулина в развитии раковой кахексии у мышей, не страдающих саркомой: особое внимание уделяется истощению мышц.J. Natl. Онкологический институт, 78 : 943-950, г. 1987.

  40. Лундхольм К., Беннегард К., Иден Э., Сванингер Г., Эмери П. В., Ренни М. Дж. Отток 3-метилгистидина из ноги у онкологических больных, которые теряют вес. Cancer Res., 42 : 4807-4811, г. 1982.

  41. Бибби М. К., Дабл Дж. А., Али С. А., Фирон К. С., Бреннан Р. А., Тисдейл М. Дж. Характеристика перевиваемой аденокарциномы толстой кишки мыши, вызывающей кахексию у животных-реципиентов.J. Natl. Онкологический институт, 78 : 539-546, 1987.

  42. Тисдейл М. Дж. Раковая кахексия. Противораковые препараты., 4 : 115-125, 1993.

  43. Lundholm K., Edstrom S., Ekman L., Karlberg I., Bylund A. C., Schersten T. Сравнительное исследование влияния злокачественной опухоли на метаболизм хозяина у мышей и человека: оценка экспериментальной модели. Рак (Phila.)., 42 : 453-461, г. 1978.

  44. Гелин Дж., Андерссон К., Лундхольм К. Эффекты индометацина, цитокинов и циклоспорина А на рост опухоли и последующее развитие раковой кахексии. Cancer Res., 51 : 880-885, г. 1991.

  45. Лундхольм К., Эдстром С., Экман Л., Карлберг И., Шерстен Т. Метаболизм в периферических тканях у онкологических больных. Лечение рака.Респ., 65 : 79-83, 1981.

  46. Карлберг И., Эдстром С., Экман Л., Йоханссон С., Шерстен Т., Лундхольм К. Метаболическая реакция хозяина в ответ на пролиферацию незлокачественных клеток против злокачественных клеток in vivo . Cancer Res., 41 : 4154-4161, г. 1981.

  47. Тернелл М., Молдавер Л. Л., Лоннрот К., Гелин Дж., Лундхольм К.G. Синтез белков плазмы при экспериментальном раке по сравнению с паранеопластическими состояниями, включая введение монокинов. Cancer Res., 47 : 5825-5830, г. 1987.

  48. Тернелл М., Захриссон Х., Лундхольм К. Активность РНК-полимеразы и синтез белка в опухоли печени мыши-хозяина по сравнению с доброкачественными паранеопластическими реакциями. Int. J. Рак, 42 : 464-469, г. 1988.

  49. Дротт К., Сванингер Г., Лундхольм К. Повышенная экскреция кортизола и катехоламинов с мочой у недоедающих онкологических больных. Аня. Surg., 208 : 645-650, 1988.

  50. Сванингер Г., Гелин Дж., Лундхольм К. Истощение опухоли-хозяина не объясняется гиперфункцией надпочечников у животных с опухолями. J. Natl. Онкологический институт, 79 : 1135-1141, г. 1987.

  51. Лённрот К., Moldawer L. L., Gelin J., Kindblom L., Sherry B., Lundholm K. Производство фактора некроза опухоли-α и интерлейкина-1α у кахектических мышей с опухолями. Int. J. Рак, 46 : 889-896, г. 1990.

  52. Чжан Дж., Ривест С. Распределение, регуляция и совместная локализация генов, кодирующих рецепторы EP2- и EP4-PGE2, в головном мозге крыс и нейронные реакции на системное воспаление. Евро. J. Neurosci., 11 : 2651-2668, г. 1999 г.

  53. Ривест С., Лакруа С., Валлиер Л., Надо С., Чжан Дж., Лафламм Н. Как кровь взаимодействует с паренхимой мозга и паравентрикулярным ядром гипоталамуса во время системных воспалительных и инфекционных раздражителей. Proc. Soc. Exp. Биол. Мед., 223 : 22-38, 2000.

Женщина, встряхивающая алмазную промышленность

Лукара установила предварительную цену в семьдесят миллионов долларов за Lesedi La Rona.Если будет достигнута цена Constellation за карат, то камень будет продаваться за восемьдесят шесть миллионов долларов. В частном порядке некоторые в Lucara думали, что рекордная природа алмаза может позволить за него выручить сто миллионов или больше. Sotheby’s, очевидно, разделял эту точку зрения. Структура договоренностей аукциониста с Лукарой означала, что он будет получать очень небольшую комиссию за бриллиант, пока цена не достигнет ста миллионов долларов; как только этот порог будет превышен, Sotheby’s получит значительную сумму.

Эйра Томас и ее отец приехали в Лондон на аукцион Sotheby’s, как и Лукас Лундин и Уильям Лэмб. Представители Graff и его главного производителя Джонни Кнеллер сидели двумя рядами позади группы Lucara. В конце концов, участник, предложивший самую высокую цену, предложил шестьдесят один миллион долларов, что значительно ниже резервной цены. Графф не делал ставки. Камень остался непроданным. После аукциона, вспоминает Лэмб, Кнеллер и другие из Граффа набросились на него «как акулы на кусок мяса», говоря: «Нам нужно поговорить.

«Мне нечего тебе сказать», — ответил Лэмб.

«Пока никаких планов не высечено, но я, вероятно, потрачу некоторое время на последний нерв моей жены, возможно, гиперфокус на лужайке». Карикатура Терезы Бернс Паркхерст

Группа Лукары пошла на обед в Мейфэр, но не пошла. выпейте шампанское, которое было заморожено. Лундин был уверен, что Лукара найдет покупателя на свой алмаз, но Лэмб был в ярости. Когда я спросил его, проводилась ли кампания по обеспечению того, чтобы аукцион закончился неудачей, Лэмб сказал мне, что это «абсолютно правильно», добавив: «Алмазная промышленность не хотела, чтобы мы продавали этот камень кому-то другому.”

В последующие недели Лэмб пытался найти частного покупателя для Lesedi La Rona. На него смотрело так много людей, что некоторые высокопоставленные лица в Лукаре задавались вопросом, не удалось ли раскрыть загадочность камня. В мире диамантеров это явление известно как «сжигание камня». В конце концов, в 2017 году Лэмб получил устное обязательство от потенциального клиента купить алмаз за шестьдесят миллионов долларов, но контракт не был подписан, и правление Лукары стало нетерпеливым. Тем временем Графф посетил Лундин на своей яхте, где он купил Lesedi La Rona за пятьдесят три миллиона долларов.Лэмб описал эту продажу как «сделку» для Граффа. Его более важная функция заключалась в восстановлении могущества старого алмазного мира. С тех пор Graff отполировал камень до различных необычных драгоценных камней, включая бриллиант изумрудной огранки D-цвета триста два карата. Сомнения по поводу цвета камня, по-видимому, не подтвердились.

«Лоуренс отлично играл в шахматы», — сказала мне Эйра Томас. «Мы даже не знали, что играем в шахматы».

Руководство Лукары решило использовать неудачный аукцион как повод для того, чтобы узнать что-то новое.Недавно Томас запустил платформу цифровых продаж под названием Clara, которая позволяет продавать необработанные алмазы розничным торговцам индивидуально. (Чтобы обеспечить безопасность финансовых транзакций, платформа использует технологию блокчейн.) Платформа работает на основе того, что каждый бриллиант имеет уникальную форму и цвет, что означает, что можно создать цифровую подпись для каждого камня и детализировать его происхождение. В случае успеха Клара будет представлять угрозу для старого алмазного мира, потому что поставщики могут связаться с покупателями без посредников.Платформа быстро растет, хотя пока нет признаков того, что она вытеснит традиционный тендерный процесс. Кэтрин Маклеод-Зельцер, соучредитель Lucara, сказала мне, что вы можете провести черту прямо от разочарования Sotheby’s до создания Клары. «Где-то в подсознании Эйры это было семя», — сказал МакЛеод-Зельцер.

В апреле прошлого года, когда был обнаружен алмаз Севело, Эйра Томас везла своих дочерей через сельскую местность Британской Колумбии, чтобы увидеть проект по добыче золота, которым руководит ее брат Гарет.Жизнь Томаса перипатична и, по ее собственному признанию, иногда хаотична. Недавно она развелась со своим мужем, канадским художником, за которого вышла замуж в 2007 году, и две их девочки, одиннадцати и девяти лет, в настоящее время живут с ней. Не так давно она переехала из Ванкувера в Лондон, где она почти никого не знает, чтобы сократить поездки и улучшить баланс между работой и личной жизнью. Она вселяет в Лукару достаточно лояльности, поэтому несколько членов ее старшей команды вырвали свои жизни, чтобы последовать за ней в Англию. Томас сказал мне, что она часто берет с собой дочерей в рабочие поездки — на Юкон или в Ботсвану — точно так же, как ее отец брал ее с собой на разведку в детстве.Она говорит, что девочки становятся такими же независимыми и адаптируемыми, как и она.

«Я никогда не выиграю« Мать года », — сказал мне Томас недавно за долгим праздничным обедом. Она сверкнула безжалостной улыбкой. «Но они получают опыт, которого не получат другие дети, и начинают это ценить».

У Томаса не было сотовой связи, когда Насим Лахри, управляющий директор Лукары Ботсваны, попытался поделиться новостью о находке Севело. Через несколько часов Томас и девочки проголодались и остановились в ресторане Little Creek Grill в маленьком городке Принстон, чтобы пообедать.В ресторане была стойка регистрации, и телефон Томаса внезапно завалили изображениями бриллианта. Сначала она не впечатлилась. «Камень был похож на авокадо», — сказал мне Томас.

Со временем она стала более взволнованной, и теперь это ее любимый камень. «Это загадка», — сказал мне Томас. «Это не так красиво, как Леседи или Созвездие. Но для меня это более ценно.

По словам Томаса, алмаз не будет хорошо представлен на традиционном тендере, потому что невозможно было точно увидеть, что могло быть внутри камня, пока в нем не были вырезаны «окна» — полированные стекла.(Черный алмаз обычно гораздо менее ценный, чем белый.) По ее оценкам, стоимость продажи Sewelô на тендере могла составлять от двух до двадцати пяти миллионов долларов, но она не была заинтересована в продаже бриллианта таким образом. Она хотела использовать продажу и изготовление Sewelô, чтобы привлечь внимание к более широким вопросам, не в последнюю очередь к отношениям алмазной промышленности к стране Ботсвана.

Многие африканские страны страдают от так называемого «ресурсного проклятия», когда природные богатства не приносят пользу населению из-за коррупции и должностных преступлений.Демократическая Республика Конго, пожалуй, самый вопиющий пример этого явления. Страна щедро богата драгоценными ископаемыми, в том числе алмазами, но на протяжении десятилетий она подвергалась преступным нарушениям и раздиралась вооруженными конфликтами. Граждане D.R.C. одни из самых бедных на земле.

В Ботсване все иначе. Это небольшая страна, не имеющая выхода к морю, с населением 2,3 миллиона человек, большая часть из которых покрыта пустынями. С 1970-х годов, когда алмазы начали добывать в значительных количествах, правительство Ботсваны взимало с производителей алмазов непомерные налоги и роялти.Правительство также владеет долей участия в предприятиях De Beers в стране, и его сделка с крупнейшим в мире алмазным конгломератом настолько хороша, что в нее трудно поверить: восемьдесят четыре процента прибыли консорциума остаются в Ботсване. Сделка Lucara менее радикальна, поскольку она полностью владеет рудником Karowe, но в 2016 году, когда она продала Constellation, фирма выплатила правительству Ботсваны восемьдесят пять миллионов долларов налогов и почти тридцать миллионов лицензионных отчислений с прибыли в размере около сто восемьдесят пять миллионов.

Эйра Томас, теперь генеральный директор из алмазной компании Lucara, с юных лет был умным, любопытным и увлеченным отдыхом. В колледже она отказалась от плана заниматься медициной и вместо этого получила степень геологии. В 1991 году, когда ей было 22 года, отец попросил ее прервать ее поездки после окончания учебы в Африку, чтобы помочь ему искать алмазы в Канаде. Фотография любезно предоставлена ​​Эйрой Томас

Сотни тысяч ботсванцев были вывезены из бедность из-за непредвиденных доходов правительства от алмазов. После обретения независимости в 1966 году более половины населения жило за чертой бедности; сейчас эта цифра составляет шестнадцать процентов.Правительство использует роялти за алмазы для финансирования инфраструктуры, здравоохранения и образования, включая ученые степени; самые многообещающие студенты могут даже получить помощь для продолжения учебы за границей. Кейт Джефферис, экономист и бывший заместитель управляющего Банка Ботсваны, сказал мне, что у Ботсваны есть свои проблемы — высокий уровень безработицы, чрезмерная зависимость от торговли алмазами, — но восходящая траектория экономики страны была головокружительной. «Вклад алмазов огромен, — сказал он.«Это действительно способствовало преобразованию очень бедной страны в страну с доходом выше среднего».

Вклад Лукары в экономику Ботсваны должен только возрасти. Когда я встретил Джона Армстронга, геолога Лукары, в Антверпене, он показал мне на своем ноутбуке прогностические модели, которые обозначили вероятность обнаружения в Карове большего количества камней, превышающих тысячу каратов. По подсчетам Армстронга, там можно было найти алмазы весом более двух тысяч каратов.Я спросил его, предсказывают ли его модели, что Лукара найдет камень даже больше, чем Куллинан. «Это малая вероятность», — сказал Армстронг. «Но возможность существует ».

В течение шести месяцев 2019 года местонахождение алмаза Sewelô было неизвестно всем, кроме избранной группы сотрудников Lucara и Одеда Мансори, диамантера из Антверпена, который держал его запертым в своем офисе. Эйра Томас не хотела повторять ошибку, которую сделала фирма с Lesedi La Rona: сожгла камень, показав его слишком большому количеству людей.Ни у одного из традиционных клиентов Лукары не будет возможности увидеть Sewelô. Когда я разговаривал с Джонни Кнеллером, производителем Graff, в октябре, он спросил меня: « вы, , видели камень?»

У меня было. В сентябре, когда я посетил Мансори в его офисе, ко мне присоединились Армстронг и Джеффри Мэддерсон из TOMRA , производитель сканеров XRT. После получасового разговора Мансори достал Sewelô из сейфа и драматично положил его на стол из красного дерева перед нами.

Я не ожидал, что меня тронет камень. Алмаз был настолько большим, что я не мог обхватить его пальцами. На большинстве фотографий цвет его кожуры кажется черным, но на фотографии он выглядел более серебристым. Камень был холодным — по крайней мере, до тех пор, пока мы все не взяли его в руки, после чего он стал теплым, как галька на солнце. Иногда он искрился. Его плоскости были гладкими, как мрамор. Теперь я понял, почему Кетшидил Тлхомеланг говорил со мной о своих чувственных удовольствиях. Алмаз тоже наводил на необычные мысли.Из-за своей темной корки камень, казалось, унес с собой свое доисторическое прошлое, в отличие от более чистых алмазов. Это было напоминанием о том, что Севело был создан до того, как атмосфера планеты содержала кислород, когда единственными формами жизни были одноклеточные организмы. В каком-то смысле, как я понял, бриллианты — это безделушки — вульгарные тотемы богатства. С другой стороны, это сосуды глубокого времени, непохожие на все остальное, что можно найти у поверхности Земли.

Мансори — бизнесмен, но он разделял это чувство удивления.Он сказал мне, что ему не хотелось делать что-либо с Sewelô, кроме как смотреть на него. Шероховатый был его первозданный вид. Он задавался вопросом, не лучше ли, чтобы бриллиант оставался неотшлифованным в витрине музея. Конечно, это было бы несостоятельно: у Лукары есть акционеры. Инвесторам нравится осознавать ценность своих активов. Несколько недель спустя я обнаружил, что в тот самый момент, когда я держал камень, Мансори и Томас разрабатывали смелый план для Севело.

Ранее в этом месяце Лукара и компания HB, основанная Мансори, подписали сделку с гигантом предметов роскоши Louis Vuitton.Sewelô теперь находится в совместном владении: у Лукары пятьдесят процентов акций, у остальных — по двадцать пять процентов каждая. Ни одна из сторон не подтвердила точную оценку стоимости Sewelô, но один знающий человек сказал мне, что цена была в «низких миллионах» долларов, отчасти из-за неопределенности в отношении внутренней части алмаза. Louis Vuitton будет продавать полированные драгоценные камни, изготовленные из камня, но, прежде чем Sewelô будет огранен, он совершит поездку по миру, чтобы познакомить людей с геологической историей алмазов.Томас также оговорил, что пять процентов чистой выручки Louis Vuitton от Sewelô будет направлено на корпоративные проекты социальной ответственности, которые Лукара реализует в Ботсване, в частности на финансирование крупной и хорошо оснащенной школы, которую компания строит недалеко от Кароу.

Сделка беспрецедентная. Материнская компания Louis Vuitton недавно купила Tiffany, но сам модный дом никогда не был серьезным розничным продавцом бриллиантов. Стать партнером в Sewelô отчасти призвано гарантировать, что его вход в алмазную сферу будет замечен.(21 января, во время Недели моды в Париже, Louis Vuitton устроил роскошную «вечеринку по случаю запуска» Sewelô.) Лукара и HB, со своей стороны, надеются разграбить эксклюзивный список богатых клиентов Louis Vuitton. Это первый раз, когда все три звена цепочки поставок алмазов — добытчик, производитель и розничный торговец — согласились работать над камнем вместе. Никакие другие фирмы, производящие предметы роскоши, не обращались; Томас связался с генеральным директором Louis Vuitton Майклом Бёрком за обедом во Флориде. Сделка была настолько секретной, что руководство Лукары даже не использовало имя Louis Vuitton во время своих внутренних обсуждений.Вместо этого их потенциальный партнер был известен как Крокодайл.

Договоренность подвергалась опасности для всех сторон. Мансори проанализировал необработанный алмаз с помощью ряда сканеров, включая адаптированный медицинский аппарат, который обычно измеряет плотность кости. К декабрю он все еще имел только общее представление о том, что скрывается под черной коркой Севело. Мансори считал, что в Севело может быть до двухсот пятидесяти карат белых бриллиантов ювелирного качества, но он не мог быть уверен в этом, пока не отполировал окна и не осмотрел интерьер.

«Будут сюрпризы», — сказал мне Мансори. Его партнер по HB, израильтянин по имени Шай де-Толедо, сказал: «Это самый спекулятивный камень в истории».

Этой сделкой Лукара в очередной раз спровоцировала традиционный алмазный бизнес, минуя брокеров Антверпена. Эйра Томас не извинилась. «У нас просто нет возможности продолжать операции с алмазами, как сегодня», — сказала она мне. «Я считаю, что вся отрасль будет двигаться в этом направлении». Срыв сделки, кажется, был сутью сделки Sewelô.Мансори недавно сказал мне, что приветствует любых кирпичных башен. По его словам, эта сделка «вызовет раздражение у каждого игрока в этой отрасли — она ​​берет игровое поле и переворачивает его с ног на голову».

Посттранскрипционная регуляция липогенеза de novo с помощью передачи сигналов mTORC1-S6K1-SRPK2

ЭКСПЕРИМЕНТАЛЬНАЯ МОДЕЛЬ И ДЕТАЛИ ПРЕДМЕТА

Клеточные линии

RT4, MCF7, DLD1, A549 и mAb104 клетки были получены из клеток ATCC. Клетки HEK293T были получены от GenHunter. Клеточная линия LAM 621-101 ( TSC2 — / — ), происходящая из ангиомиолипомы почек человека, иммортализованная HPV E6 / E7 и hTERT, была описана ранее (Yu et al., 2004). Линия клеток ELT3 ( Tsc2 — / — ), происходящая от лейомиомы матки крыс Eker, была предоставлена ​​Cheryl Walker (Техасский университет A&M) (Howe et al., 1995) и использовалась для создания клеточной линии ELT3-люциферазы, стабильно экспрессирующей люциферазу в виде описано ранее (Yu et al., 2009). Tsc2 — / — эмбриональные фибробласты мыши (MEF) были предоставлены Дэвидом Квятковски (Гарвардская медицинская школа) (Zhang et al., 2003). Клетки выращивали в следующих средах при 37 ° C с 5% CO 2 , если не указано иное.HEK293E, HEK293T, RT4 и Tsc2 — / — MEF культивировали в DMEM с 10% FBS. Клетки MCF7, DLD1 и A549 культивировали в RPMI с 10% FBS. Клетки мАт104 культивировали в модифицированной Iscove среде Дульбекко (IMDM) с 20% FBS. Клетки LAM 621-101 и ELT3 культивировали в полной среде IIA (DMEM / F12, 10% FBS, 1 нМ трийодтиронина, 10 мкЕ / мл вазопрессина, 200 нМ гидрокортизона, 50 нМ селенита натрия, 10 нМ холестерина, 20 нг / мл EGF. , 25 мкг / мл инсулина, 10 мкг / мл трансферрина и 1,6 мкМ сульфата железа) (Yu et al., 2004; Ю. и др., 2009).

Мыши

Вся работа с животными выполнялась в соответствии с протоколами, утвержденными постоянными комитетами по животным при Университете Цинциннати. Использовали самок мышей CD-1 nude в возрасте 6-8 недель (Charles River), мышей NOD / SCID-gamma (лаборатория Jackson) и мышей CB17-scid (Taconic).

Штаммы микробов

E. coli BL21 (New England Biolabs) выращивали при 28 ° C в среде 2x YTA для очистки белка.

ПОДРОБНОЕ ОПИСАНИЕ МЕТОДОВ

Антитела и низкомолекулярные ингибиторы

Cell Signaling Technology разработала специально для этого исследования антитела pSRPK2 (S494), pSRPK2 (S497) и pSRPK2 (S494 / S497).Антитела были получены из следующих источников: SRPK1 и SRPK2 от BD Biosciences; ACLY, FASN, SCD1, S6, pS6 (S235 / S236), pS6 (S240 / S244), S6K1, pS6K1 (T389), TSC2 и V5 от Cell Signaling Technology; ACSS2 и GAPDH от Sigma-Aldrich; FDFT1 от Abcam; SRSF1, ACTIN, GST, LAMIN A / C и SREBP1 из Санта-Крус; HA от Covance; U1-70k от Synaptic Systems. Моноклональные антитела к фосфорилированным белкам SR получали из линии гибридомных клеток мАт104 (АТСС) () или приобретали у invitrogen (mAB1h5) ().Реагенты были получены из следующих источников: инсулин, рапамицин, PF4708671 и актиномицин D от Sigma-Aldrich; Torin1 от Tocris Bioscience; рапамицин от Calbiochem; MK2206 от Cayman Chemical; SRPIN340 от Selleck Chemicals и Milstein Chemistry Core Facility (Weill Cornell Medicine).

Анализ экспрессии генов и измерение стабильности мРНК
РНК

выделяли с помощью набора RNeasy Mini Kit (Qiagen) или PureLink RNA Mini Kit (Ambion) и обрабатывали ДНКазой I (Qiagen или Sigma-Aldrich) в соответствии с инструкциями производителей.После обратной транскрипции 500-1000 нг РНК (набор для синтеза кДНК iScript, Bio-rad) полученную кДНК разводили в воде, свободной от нуклеаз (1: 5), с последующей количественной ПЦР в реальном времени (qPCR) с использованием QuantStudio 6 Flex. (Прикладные биосистемы). Уровни экспрессии генов были нормализованы до уровня экспрессии генов домашнего хозяйства ACTIN , ТАТА-связывающего белка ( TBP ) или Пептидилпропилизомеразы B ( PPIB ). Для измерения стабильности мРНК транскрипцию блокировали обработкой актиномицином D (5 мкг / мл) в течение 0, 2 и 4 часов.Обратную транскрипцию выполняли с использованием одного и того же объема РНК для всех временных точек, а уровни мРНК измеряли с помощью кПЦР (Tani and Akimitsu, 2012).

Микроматрица цельного транскриптома человека

Тотальную РНК выделяли с использованием RNeasy Mini Kit (Qiagen) и обрабатывали ДНКазой I (Qiagen). Микроматрица была выполнена центром трансляционной геномики компании Partners HealthCare Personalized Medicine (Массачусетс, США) в соответствии с протоколом Affymetrix. Вкратце, 100 нг тотальной РНК использовали для синтеза биотинилированной кДНК с использованием полного транскрипта GeneChip (WT) плюс набор реагентов.5,5 мкг кДНК фрагментировали и метили концевой дезоксинуклеотидилтрансферазой (набор для концевого мечения GeneChip WT). Полученную кДНК гибридизовали с массивом Human Transcriptome 2.0 при 45 ° C в течение 16 часов. Чипы матрицы были промыты и закреплены с использованием станции 450 GeneChip fluidics и сканированы с использованием GeneChip Scanner 3000 7G. Данные анализировали с помощью Expression console (Affymetrix) и программного обеспечения консоли анализа Transcriptome (Affymetrix) в соответствии с инструкциями производителя.

ВЭЖХ-анализ синтеза липидов de novo

Клетки в 6-луночном планшете культивировали в бессывороточной среде DMEM (5.5 мМ глюкозы) в течение ночи или в течение 24 часов (для условий лечения лекарственными препаратами) и метили [1- 14 C] -ацетат (2-8 мкКи / лунку) (Perkin Elmer) в течение последних 6 часов. Клетки трижды промывали PBS и лизировали метанолом, содержащим внутренний стандарт 13 (S) -гидроксиоктадекадиеновой кислоты [13 (S) -HODE] (2 мкг / лунку) (Cayman Chemicals). Лизаты клеток собирали с помощью скребка для клеток и переносили в стеклянный флакон. Липиды экстрагировали добавлением хлороформа и воды (метанол: хролоформ: вода = 1: 1: 0.9, по объему). После центрифугирования (800 об / мин, 10 мин) нижнюю фазу переносили в новый сосуд и упаривали в потоке N 2 . Затем липиды растворяли в метаноле (1 мл), гидролизовали 0,5 мл 1 н. NaOH при комнатной температуре в течение 2 часов и повторно экстрагировали, добавляя хлороформ (2 мл), 1 н. HCl (0,5 мл) и воду ( 2 мл). После центрифугирования нижнюю фазу переносили в новый флакон. Образцы упаривали в потоке N 2 и растворяли в 0,2 мл смеси гексан: изопропанол: уксусная кислота (100: 3: 0.02, по объему) для анализа ВЭЖХ. Образцы анализировали с использованием колонки Agilent Zorbax Silica (5 мкм, 4,6 × 250 мм) с изократическим элюированием гексан: изопропанол: уксусная кислота (100: 3: 0,02 по объему) при скорости потока 1 мл / мин в течение 12 мин. на бинарной системе Agilent 1260 Infinity с детектором с диодной матрицей, соединенным с радиометрическим детектором Perkin-Elmer 150TR (Zheng et al., 2011). Время удерживания жирных кислот и холестерина определяли по стандартным липидам. Площади пиков радиоактивно меченных жирных кислот и холестерина были интегрированы (Agilent OpenLAB CDS ChemStation) и нормализованы до значения 13 (S) -HODE и количества клеток.

ЖХ-МС анализ омыленных жирных кислот

Экстракцию и ЖХ-МС анализ жирных кислот проводили, как описано ранее (Kamphorst et al., 2013). Вкратце, в клетки в 60-миллиметровом планшете добавляли 17,5 мМ [U- 13 C] -глюкозы (Cambridge Isotope Laboratories) в DMEM / F12 с или без 10% диализованного FBS (Sigma-Aldrich) или сыворотки с дефицитом липопротеинов. (Intracel или Alfa Aesar) на 48 часов. Клетки трижды промывали PBS и лизировали 2 мл 0.3 М КОН в 90% метаноле. Лизаты клеток собирали с помощью скребка для клеток и переносили в стеклянный флакон. Липиды гидролизовали при 80 ° C в течение 1 часа и добавляли муравьиную кислоту (0,2 мл) для нейтрализации. Липиды экстрагировали дважды, добавляя 2 мл гексана и перенося верхний слой в новый флакон. Образцы упаривали в потоке N 2 и растворяли в 0,1 мл раствора изопропанол: метанол (1: 1, об. / Об.) Для анализа ЖХ-МС (Stand-alone Orbitrap, Thermo Fisher). Синтезированные de novo жирные кислоты определяли на основе суммы всех форм, содержащих четыре или более меченых атома углерода (жирные кислоты, содержащие два меченых атома углерода, получены в результате удлинения, а не синтеза de novo).Анализ данных с помощью программного обеспечения MAVEN и поправка на естественные изотопы были выполнены, как описано ранее (Kamphorst et al., 2013).

Анализ пролиферации клеток

Клетки, засеянные на 12-луночный планшет (LAM 621-101, 2 × 10 3 клеток; MCF7 и RT4, 2 × 10 4 клеток), выращивали в среде (LAM 621- 101, DMEM / F12; MCF7, RPMI; RT4, DMEM) с 10% FBS или LPDS в течение 8 дней. В среду добавляли липопротеин (25 мкг / мл), альбумин олеиновая кислота (50 мкМ) или альбумин без жирных кислот (25 мкМ).Окрашивание кристальным фиолетовым проводили для визуализации клеток. Вкратце, клетки фиксировали 4% формальдегидом без метанола (Polysciences) в PBS в течение 30 минут и промывали PBS. Клетки инкубировали с 0,1% раствором кристаллического фиолетового (Sigma-Aldrich) в течение 30 мин при комнатной температуре. После пятикратной промывки водой планшет сушили на воздухе и сканировали. Количественная оценка проводилась с помощью денситометрического анализа изображений с помощью Adobe Photoshop.

Анализ опухоли ксенотрансплантатом in vivo

Все работы с животными выполнялись в соответствии с протоколами, утвержденными постоянными комитетами по животным при Университете Цинциннати.Самки мышей CD-1 nude (Charles River) (линия клеток A549), мыши NOD / SCID-gamma (лаборатория Jackson) (линия клеток LAM 621-101) и мыши CB17-scid (Taconic) (клетки RT4 и ELT3-люциферазы линий) в возрасте от 6 до 8 недель. 2 × 10 6 клеток подкожно инокулировали в задние области спины каждой мыши. После образования опухоли через 3-5 недель после инокуляции длину и ширину опухоли измеряли с помощью цифрового штангенциркуля. Объем опухоли рассчитывали по формуле: объем = (длина × (ширина) 2 /2).Для эксперимента по лечению лекарственным препаратом мышей рандомизировали на две группы после образования опухоли и ежедневно обрабатывали либо контрольным носителем (100 мкл 1% ДМСО в PBS), либо SRPIN340 (100 мкл 20 мкг / мл; 1% ДМСО в PBS). перитуморальная инъекция, как описано ранее (Gammons et al., 2014). SRPIN340 растворяли в концентрации 2 мг / мл в ДМСО, и этот исходный раствор разбавляли 1: 1000 с использованием PBS перед инъекцией. Для биолюминесцентной визуализации опухолей ELT3-люциферазы люциферин (120 мг / кг, ксеноген) вводили мыши внутрибрюшинно за 10 минут до визуализации.Биолюминесцентные сигналы регистрировали с помощью системы Xenogen IVIS, а общий поток фотонов опухолей анализировали, как описано ранее (Yu et al., 2009).

Масс-спектрометрический анализ интерактома SRSF1

Клетки HEK293E трансфицировали пустым вектором (EV) или pLX304-SRSF1-V5. После 24 часов трансфекции клетки обрабатывали носителем (DMSO) или Torin1 (250 нМ) в течение дополнительных 4 часов в соответствии с тремя экспериментальными условиями: EV + DMSO, SRSF1-V5 + DMSO и SRSF1-V5 + Torin1.Клетки промывали один раз ледяным PBS и разрушали на льду буфером для лизиса (50 мМ Tris-Cl буфер [pH 8], 150 мМ NaCl и 0,5% NP-40) с добавлением ингибиторов протеаз (250 мкМ PMSF, 5 мкг. / мл пепстатина А, 10 мкг / мл лейпептина и 5 мкг / мл апротинина), ингибиторы фосфатазы (PhosSTOP, Roche) и ингибитор РНКазы (160 ед / мл). Лизаты гомогенизировали шприцем. Очищенные лизаты получали центрифугированием при 15000 об / мин при 4 ° C в течение 30 мин. Для совместной иммунопреципитации лизаты инкубировали с аффинным гелем анти-V5 агарозы (Sigma-Aldrich) при 4 ° C в течение 2.5 часов и трижды промывали буфером для лизиса. Иммунопреципитированные белки анализировали иммуноблоттингом или дополнительно обрабатывали для масс-спектрометрического (МС) анализа.

Для анализа MS иммунопреципитированные белки элюировали из шариков путем инкубации с пептидом V5 (Sigma-Aldrich) в течение ночи при 4 ° C. Белковые элюаты осаждали трихлоруксусной кислотой (TCA, 20% мас. / Об.), Трижды промывали ацетоном и сушили при комнатной температуре. Осадки ресуспендировали в 50 мкл буфера для ресуспендирования (8 М мочевина, 50 мМ бикарбонат аммония и 5 мМ DTT) и подвергали реакции восстановления и алкилирования.Вкратце, к каждому образцу добавляли 15 мМ йодацетамида на 30 мин в темноте при комнатной температуре с последующим добавлением еще 5 мМ DTT для гашения реакции. Образцы разбавляли до конечной концентрации 1 М мочевины, а затем затем расщепляли LysC (комнатная температура, в течение ночи) и трипсином (37 ° C, в течение ночи) (каждый в соотношении 1: 125, фермент: белок).

Затем образцы метили с использованием триплекс-восстановительного диметилирования (Boersema et al., 2008). Мечение производилось, пока пептиды были связаны с твердофазной смолой C18 в самоупакованных микроколонках STAGE с наконечником.Наконечники ступеней промывали, как описано ранее, метанолом, ацетонитрилом (ACN, 70% об. / Об.) И муравьиной кислотой (FA, 1% об. / Об.) И, наконец, 1% FA. Образцы подкисляли, добавляя 100% ЖК до конечной концентрации 2% ЖК перед загрузкой. После загрузки образца наконечники предметных столов промывали 1% ЖК и фосфатно-цитратным буфером (0,23 М фосфата натрия и 86,4 мМ лимонной кислоты [pH 5,5]). На данный момент «легкий» раствор для EV + DMSO (0,4% CH 2 O и 60 мМ NaBH 3 CN) ’,« средний »раствор для SRSF1-V5 + DMSO (0.4% CD 2 O и 60 мМ NaBH 3 CN) или добавлен «тяжелый» раствор для SRSF1-V5 + Torin1 (0,4% 13 CD 2 O и 60 мМ NaBD 3 CN) дважды на каждом этапе наконечник для маркировки пептидов. Конечную промывку 1% FA проводили перед элюированием 70% ACN и 1% FA. Образцы сушили в вакууме, ресуспендировали в 5% FA и смешивали вместе в равных количествах для анализа с использованием масс-спектрометра Orbitrap Fusion (Thermo Fisher). Пептиды вводили в масс-спектрометр с помощью нано-электрораспыления по мере их элюирования из самоупакованной колонки с обращенной фазой 40 см, 75 мкм (ID), заполненной 1.8 мкм, размер пор 120 Å, смола SEPAX C18. Пептиды разделяли градиентом 5-25% буфера B (99,9% ACN, 0,1% FA) со скоростью потока 350 нл / мин в течение 85 мин. Для каждого цикла сканирования в масс-анализаторе Orbitrap было получено одно полное МС-сканирование с высоким массовым разрешением с разрешением 120K, значением AGC 500000, в диапазоне сканирования am / z 375-1400, максимальное время сбора данных от 100 мс и до 20 родительских ионов были выбраны на основе их интенсивности для индуцированной столкновением диссоциации (нормализованная энергия столкновения = 35%) и сканирования фрагментов МС / МС с низким разрешением по массе в линейной ионной ловушке.Включено динамическое исключение, чтобы исключить ионы, которые уже были выбраны для МС / МС за предыдущие 40 секунд. Исключались также ионы с зарядом +1 и те, чье состояние заряда нельзя было присвоить. Все сканы были собраны в режиме центроида.

Были обработаны и проанализированы две биологические копии для каждого условия. Все необработанные масс-спектральные данные были обработаны с использованием аналитической платформы Maxquant, а последующая визуализация и статистический анализ были выполнены с помощью Perseus (Tyanova et al., 2016). Поиск спектров проводился с использованием алгоритма Андромеды. Перед запуском Maxquant были установлены следующие динамические и фиксированные модификации: окисление метионина и ацетил-протеина N-термин (как динамический), карбамидометил в цистеинах (как фиксированный). Спектральные совпадения были отфильтрованы до 1% ложноположительных результатов.

Культура клеток SILAC и масс-спектрометрический анализ фосфорилированных белков

Эксперименты по приготовлению образцов для мечения стабильных изотопов аминокислотами в культуре клеток (SILAC) и анализ ЖХ-МС / МС были описаны ранее (Yu et al., 2011). Вкратце, Tsc2 — / — MEF были выращены на свету ([ 12 C 6 14 N 2 ] -Lys, [ 12 C 6 14 N 4 ] — Arg) или тяжелый ([ 13 C 6 15 N 2 ] -Lys, [ 13 C 6 15 N 4 ] -Arg) (Cambridge Isotope Laboratories) с добавлением DMEM с 10% диализованным FBS. Клетки голодали по сыворотке в течение 17 часов и обрабатывали носителем или рапамицином (20 нМ) в течение 2 часов.Клетки лизировали и расщепляли трипсином, а фосфопептиды обогащали методом SCX-IMAC. Образцы анализировали с помощью масс-спектрометра LTQ-Orbitrap (Thermo Fisher), как описано ранее (Yu et al., 2011).

Иммунопреципитация РНК-белка (RNA-IP)

Иммунопреципитация РНК-белка выполнялась с использованием набора Imprint RNA для иммунопреципитации (RIP) (Sigma-Aldrich) в соответствии с протоколом производителя. Клетки на 15-см планшете дважды промывали ледяным PBS и собирали в пробирку Эппендорфа.Клетки собирали центрифугированием при 3000 об / мин при 4 ° C в течение 5 минут. Осадки клеток повторно обрабатывали 100 мкл сильного буфера для лизиса (набор RIP) с добавлением ингибиторов протеаз (коктейль ингибиторов протеаз, 1 мкл) и ингибитора РНКазы (160 единиц / мл) и инкубировали на льду в течение 15 мин. Лизаты клеток мгновенно замораживали в жидком азоте и оттаивали на льду.

Для получения предварительно связанных шариков с антителами 5 мкг мышиного IgG (EMD Millipore) или антитела против SRSF1 (Santa Cruz) конъюгировали с магнитными шариками с 50 мкл белка A / G (Thermo Fisher).Лизаты клеток и гранулы, предварительно связанные с антителами, инкубировали в 1 мл буфера RIP при 4 ° C в течение 3 часов. Гранулы промывали и элюировали РНК, инкубируя 150 мкл буфера RIP, содержащего 1% SDS и 1,2 мг / мл протеиназы K (New England Biolabs), при 55 ° C в течение 30 минут. Элюированную РНК дополнительно очищали экстракцией фенонол / хролоформ и осаждали ацетатом аммония и этанолом. Входные и иммунопреципитированные РНК обрабатывали ДНКазой I (Sigma-Aldrich) и подвергали обратной транскрипции (набор для синтеза кДНК iScript, Bio-rad), а полученную кДНК анализировали с помощью кПЦР, как описано в разделе анализа экспрессии генов.[Ct (ввод) — Ct (IP)].

Анализ активности промотора люциферазы

Клетки, помещенные на 6-луночный планшет, котрансфицировали 1 мкг конструкции renillia, содержащей промотор интересующего гена и 0,2 мкг контрольной конструкции ципридина, с использованием реагента для трансфекции FuGENE HD (Promega). Для котрансфекции люциферазных конструкций с миРНК использовали набор SE Cell Line 4D-Nucleofector X и 4D-Nucleofector system (Lonza). Через 48 часов после трансфекции активность люциферазы измеряли с помощью системы двойного анализа LightSwitch (SwitchGear Genomics) в соответствии с протоколом производителя.Активность люциферазы Renilla нормализовалась по активности люциферазы ципридина.

Экспрессионные конструкции и мутагенез

Для исследований экспрессии кодирующая последовательность человеческого SRPK2 (NM_001278273.1) была клонирована в вектор pKh4 (BclI / BamHI и MfeI / EcoRI), а HA-SRPK2 из pKh4-SRPK2 была субклонирован в вектор pLNCX (NotI и SalI). Для создания GST-меченного белка SRPK2 для киназных анализов in vitro 454-521 аминокислоту SRPK2 клонировали в вектор pGEX-2T (EcoRI).pLX304-SRSF1-V5 и pCMV-SPORT6-mouse Srpk2 были получены от Harvard PlasmID. Для создания pLenti-Blast-mouse Srpk2, pCMV-SPORT6-Srpk2 рекомбинировали с вектором pDONR223 с помощью реакции BP (смесь ферментов Gateway BP clonase II, Invitrogen), и полученный pDONR223-Srpk2 рекомбинировали с вектором pLenti-Blast-DEST с помощью Lenti-Blast-DEST. реакции (смесь ферментов клоназы II Gateway LR, Invitrogen). Мутанты SRPK2 (S494A, S494D, S497A, S494A / S497A и K110M для SRPK2 человека; S488A / S491A для Srpk2 мыши) были созданы с использованием набора для сайт-направленного мутагенеза QuickChange (Strategene).Конститутивно активная конструкция S6K1 (pKh4-S6K1-F5A / T389E / R3A) была описана ранее (Schalm and Blenis, 2002).

Экспрессия миРНК и shРНК

Объединенные миРНК (30 нМ) трансфицировали с использованием реагента Lipofectamine RNAiMAX. Для эксперимента по спасению использовали 10 нМ миРНК, нацеленную на 3 ’UTR из SRPK2 (SASI_Hs01_00057789). Конструкции pLKO.1 shRNA были от RNAi Consortium (TRC) в Институте Броуда: shGFP (TRCN0000072181), shSRPK2 # 6 (TRCN0000006274, нацеленный на 3 ’UTR) и shSRPK2 # 10 (TRCN0000006278, нацеленный на CDS).Результаты shSRPK2 # 6 показаны как репрезентативные данные, если не указано иное.

Нокаут CRISPR / Cas9

Каждая направляющая последовательность РНК, нацеленная на человеческий SRPK2 (GCATTATACGGAGACAGCCT, GGATCCGCGGAATGCAGATA и GACGCGTCAGTACCGCTCCA), была клонирована в векторе lentiCRISPRv2 et al. (Sanjana et al., 2014). Клетки LAM 621-101 инфицировали вирусными супернатантами, полученными из lentiCRISPRv2, и отбирали пуромицином (10 мкг / мл). Клонирование единичных клеток выполняли серийным разведением в 96-луночных планшетах с последующим иммуноблот-анализом SRPK2 для подтверждения эффективности нокаута нескольких выбранных клонов.Показан результат иммуноблота клеток с нокаутом SRPK2 , созданных из направляющей РНК, GCATTATACGGAGACAGCCT.

Создание стабильных клеточных линий

Клетки HEK293T котрансфицировали представляющей интерес вирусной плазмидой упаковкой и плазмидами оболочки в соответствии с вирусными векторами (pLKO.1, pLenti-Blast и lentiCRISPRv2, лентивирус; pLNCX, ретровирус) с использованием липофектамина. 2000, как описано ранее (Csibi et al., 2014). Супернатанты, содержащие вирус, собирали через 48 часов после трансфекции.Клетки-мишени инфицировали вирусным супернатантом, отфильтрованным 0,45 мкМ, в присутствии полибрена 8 мкг / мл в течение 24 часов. pLKO.1 или инфицированные lentiCRISPRv2 клетки LAM 621-101 отбирали с помощью 10 мкг / мл пуромицина. pLKO.1-инфицированные клетки A549 отбирали с помощью 2 мкг / мл пуромицина. Клетки LAM 621-101, инфицированные pLenti-Blast, отбирали с 30 мкг / мл бластицидина. Клетки LAM 621-101, стабильно экспрессирующие пустой вектор, или TSC2 были предоставлены Элизабет Хенске (Siroky et al., 2012).

Лизис, фракционирование, иммунопреципитация и иммуноблоттинг

Клетки дважды промывали ледяным PBS и гомогенизировали на льду либо в обычном буфере для лизиса (40 мМ HEPES [pH 7.4], 1 мМ EDTA, 120 мМ NaCl, 0,5 мМ DTT, 10 мМ β-глицерофосфат, 1 мМ NaF, 1 мМ Na 3 VO 4 , 0,1% Brij-35, 0,1% дезоксихолат и 0,5% NP -40) или в буфере для лизиса Triton X-100 (40 мМ HEPES [pH 7,4], 1 мМ EDTA, 120 мМ NaCl, 0,5 мМ DTT, 10 мМ β-глицерофосфат, 1 мМ NaF, 1 мМ Na 3 VO 4 и 1% Triton X-100) с добавлением ингибиторов протеаз (250 мкМ PMSF, 5 мкг / мл пепстатина A, 10 мкг / мл лейпептина и 5 мкг / мл апротинина). Лизаты клеток очищали центрифугированием при 13000 об / мин при 4 ° C в течение 20 минут.Выделение ядерных и цитоплазматических фракций выполняли с использованием набора NE-PER (Thermo Fisher Scientific) в соответствии с протоколом производителя. Концентрацию белка измеряли с помощью анализа Брэдфорда (Bio-rad), и белки денатурировали кипячением в течение 10 минут в буфере для образцов. 15–30 мкг белков анализировали иммуноблоттингом, как описано ранее (Csibi et al., 2014). Сигналы иммуноблота детектировались системой визуализации Odyssey (LI-COR Biosciences) или усиленной хемилюминесценцией (ECL) и количественно определялись денситометрическим анализом белковых полос с использованием системы визуализации Adobe Photoshop или Odyssey.Изображения иммуноблота представляют как минимум два независимых эксперимента. Цифры под полосами иммуноблота указывают среднюю интенсивность полосы двух репрезентативных изображений иммуноблота, нормализованную к контролю нагрузки.

Для лечения щелочной фосфатазой кишечника теленка (CIAP, New England Biolabs) клетки лизировали в буфере CIAP (New England Biolabs) с добавлением 1% Triton X-100, 1 мМ DTT и ингибиторов протеаз. 50 мкг клеточных лизатов обрабатывали 50 единицами CIAP при 37 ° C в течение 1 часа.

Для иммунопреципитации HA-S6K1 клетки лизировали с использованием буфера для лизиса Triton X-100 (без DTT). 1 мг клеточных лизатов инкубировали с первичными антителами при 4 ° C в течение 4 часов с последующей инкубацией с 50% взвесью шариков протеин A / G сефарозы (GE Healthcare Life Sciences), предварительно насыщенных буфером для лизиса, в течение еще 1 часа. После трехкратной промывки буфером для лизиса иммунопреципитированные белки использовали для дальнейшего анализа.

Очистка белка и анализы киназ in vitro

Для очистки белка GST-SRPK2, E.coli BL21 (New England Biolabs) трансформировали плазмидами pGEX-2T-SRPK2. Бактерии выращивали при 28 ° C в среде 2x YTA, содержащей 100 мкг / мл ампициллина, до A 600 , равного 0,6–0,8, с последующей обработкой 100 нМ IPTG в течение 2 часов для индукции экспрессии белка. Клетки собирали центрифугированием при 6000 g при 4 ° C в течение 15 минут и ресуспендировали в ледяном PBS. Клетки лизировали с помощью ультразвукового аппарата с последующей инкубацией с 1% Triton X-100 при 4 ° C в течение 30 минут. Клеточные лизаты центрифугировали при 12000 g при 4 ° C в течение 10 мин и инкубировали с 50% взвесью глутатион-сефарозы 4B (GE Healthcare Life Sciences) при 4 ° C в течение 2 часов.После трехкратного промывания PBS протеины элюировали 1 мл элюирующего буфера (50 мМ трис-HCl и 10 мМ восстановленный глутатион, pH 8,0).

Для анализа киназы S6K1 in vitro иммунопреципитированный HA-S6K1 из HEK293E инкубировали с 1 мкг GST-SRPK2 в буфере для анализа киназы (25 мМ Tris-HCl, [pH 7,4], 10 мМ MgCl 2 , 5 мМ β-глицерофосфат, 2 мМ DTT и 100 мкМ АТФ), содержащий 5 мкКи [γ- 32 P] -АТФ (Perkin Elmer), при 30 ° C в течение 20 мин. Для анализа киназы CK1 in vitro 200 нг GST-CK1 (EMD Millipore) инкубировали с GST-SRPK2 в буфере для анализа киназы, содержащем 5 мкг [γ- 32 P] -ATP, при 30 ° C в течение 30 мин.Образцы разделяли с помощью SDS-PAGE, наносили на нитроцеллюлозную мембрану и подвергали авторадиографии.

Иммунофлуоресцентное окрашивание

Клетки, выращенные на фибронектине и покрытом желатином стекле в 12-луночном планшете, фиксировали 4% -ным формальдегидом без метанола в PBS в течение 30 мин. Клетки промывали PBS и повышали проницаемость с помощью 0,1% Triton X-100 в PBS в течение 10 мин. Затем клетки блокировали в течение 1 часа блокирующим буфером (смесь 50:50 0,1% буфера Triton X-100 и блокирующего буфера LI-COR, LI-COR Biosciences) и инкубировали с анти-SRPK2 (разведение 1: 100, BD Biosciences) и антитела против pS6 (S235 / S236) (разведение 1: 200, Cell Signaling Technology) в блокирующем буфере в течение ночи при 4 ° C.После трехкратной промывки буфером Triton X-100 клетки инкубировали со вторичными антителами, конъюгированными с Alexa488 или с Alexa568 (разведение 1: 1000 в блокирующем буфере), при комнатной температуре в течение 1 часа и трижды промывали Triton X- 100 буфер. Затем клетки инкубировали с 0,5 мкг / мл Hoechst 33258 (Thermo Fisher) в PBS в течение 10 мин, дважды промывали PBS и помещали на предметные стекла с монтажной средой Dako (Sigma-Aldrich). Изображения были получены с помощью вертикального микроскопа Nikon или лазерного сканирующего конфокального микроскопа Zeiss и проанализированы с помощью программного обеспечения MetaMorph в Центре визуализации Nikon (Гарвардская медицинская школа).Для количественной оценки количества клеток относительно ядерно-цитоплазматической локализации SRPK2 в контрольных клетках измеряли среднюю интенсивность ядерной-SRPK2 (площадь ядра определяется как перекрывающаяся с сигналом DAPI), а в клетках, содержащих ядерно-цитоплазматическую локализацию SRPK2, интенсивность выше средней интенсивности. контроля считали ядром.

Биоинформатика и анализ in silico

Для анализа обогащения онтологией генов (GO) (рисунок S2C и таблица S2D) список генов был загружен на веб-сайт базы данных DAVID (http: // david.abcc.ncifcrf.gov) для анализа биологических путей. Критериями, выбранными для анализа, были: идентификатор гена (OFFICIAL_GENE_SYMBOL), фоновые гены (весь геном человека) и аналитический инструмент (функциональная аннотация).

Для анализа обогащения фактора транскрипции (рисунок S2D) список генов был загружен в набор инструментов анализа набора генов в Интернете (http://www.webgestalt.org) для идентификации обогащения сайта связывания фактора транскрипции в вышестоящем промоторе. регионы. Критериями, выбранными для анализа, были: организм (hsapiens), метод (анализ избыточного представительства, ORA), функциональная база данных (сеть, Transcription_factor_target), тип идентификатора гена (символ гена) и эталонный набор для анализа обогащения (affy_hta_2_0).

Для анализа предполагаемых сайтов связывания SRSF1, SRSF2 и SRSF3 (таблица S1) последовательность мРНК транскриптов была загружена на веб-сервер для картирования сайтов связывания РНК-связывающих белков (http://rbpmap.technion.ac. il) (Paz et al., 2014). Критериями, выбранными для анализа, были: РНК-связывающий белок (человеческие / мышиные мотивы; SRSF1, SRSF2 и SRSF3) и уровень строгости (высокая строгость).

Произошла ошибка при настройке пользовательского файла cookie

Этот сайт использует файлы cookie для повышения производительности.Если ваш браузер не принимает файлы cookie, вы не можете просматривать этот сайт.


Настройка вашего браузера для приема файлов cookie

Существует множество причин, по которым cookie не может быть установлен правильно. Ниже приведены наиболее частые причины:

  • В вашем браузере отключены файлы cookie. Вам необходимо сбросить настройки своего браузера, чтобы он принимал файлы cookie, или чтобы спросить вас, хотите ли вы принимать файлы cookie.
  • Ваш браузер спрашивает вас, хотите ли вы принимать файлы cookie, и вы отказались.Чтобы принять файлы cookie с этого сайта, используйте кнопку «Назад» и примите файлы cookie.
  • Ваш браузер не поддерживает файлы cookie. Если вы подозреваете это, попробуйте другой браузер.
  • Дата на вашем компьютере в прошлом. Если часы вашего компьютера показывают дату до 1 января 1970 г., браузер автоматически забудет файл cookie. Чтобы исправить это, установите правильное время и дату на своем компьютере.
  • Вы установили приложение, которое отслеживает или блокирует установку файлов cookie.Вы должны отключить приложение при входе в систему или проконсультироваться с системным администратором.

Почему этому сайту требуются файлы cookie?

Этот сайт использует файлы cookie для повышения производительности, запоминая, что вы вошли в систему, когда переходите со страницы на страницу. Чтобы предоставить доступ без файлов cookie потребует, чтобы сайт создавал новый сеанс для каждой посещаемой страницы, что замедляет работу системы до неприемлемого уровня.


Что сохраняется в файле cookie?

Этот сайт не хранит ничего, кроме автоматически сгенерированного идентификатора сеанса в cookie; никакая другая информация не фиксируется.

Как правило, в файле cookie может храниться только информация, которую вы предоставляете, или выбор, который вы делаете при посещении веб-сайта. Например, сайт не может определить ваше имя электронной почты, пока вы не введете его. Разрешение веб-сайту создавать файлы cookie не дает этому или любому другому сайту доступа к остальной части вашего компьютера, и только сайт, который создал файл cookie, может его прочитать.

Архив событий | Страница 12 из 90

через Французский комитет по Яд Вашем.Пожилой Аристид Гаснье, мэр Вибрае, с двумя американскими солдатами и несколькими еврейскими беженцами, которых он помог спасти во время нацистской оккупации; Югетт стоит прямо перед Гаснье; ее старший брат Морис — мальчик в крайнем правом углу. Сарт, Франция, 1944 г.

Мэтт Ситон
New York Review of Books
12 марта 2020 г.

Наш друг Хугетт Мартель — художник и учитель французского языка. Когда она была моложе, она рисовала мультфильмы для The New Yorker, а также давала уроки языка сотрудникам.Не так давно она переехала в то же здание на Манхэттене, где мы с женой живем, и, видя ее чаще, чем раньше, я узнал больше о ее истории — не то, на что она, чрезвычайно скромный человек, естественно, давит.

Так случилось, что я услышал чудесную сагу о том, как она, дитя французско-еврейских беженцев, пережила Холокост; а затем Daily опубликовала ее живописные мемуары «Взросление во Франции во время войны», в которых рассказывается об основных моментах ее истории.Но история оказалась довольно развязной, поскольку эта версия — единственная, которую она знала в течение первых восьми десятилетий своей жизни — была существенно неполной. Полная история была еще более примечательной.

Гугетт родился в Париже в 1938 году, был вторым ребенком Менделя Файвелевича и его жены Рывки, иммигрантов из Литвы. У нее также был брат Морис, который был на пять лет старше, и все вместе семья жила в районе Марэ в центре Парижа, где Мендель занимался оптовой торговлей рабочей одеждой.После вторжения немцев в 1940 году семья бежала в деревню. Они так и не добрались до «свободной зоны» вишистской Франции, а вместо этого нашли убежище в оккупированной сельской местности под названием Сарт, названной в честь притока Луары. Они поселились в Вибрае, деревне примерно в ста милях к юго-западу от Парижа, недалеко от города Ле-Ман, известного своими автодромами.

Югетте в то время было два года, поэтому точные обстоятельства всегда были для нее неясными, но каким-то образом они с Морисом оказались в крестьянской семье, а их родители нашли такое же убежище поблизости.Ее отец платил семье за ​​содержание детей, но в какой-то момент у него закончились деньги. Итак, в июле 1942 года Фаджвелевичи предприняли рискованное путешествие обратно в Париж, взяв с собой Югетта, чтобы Мендель мог обменять часть хранящихся у него запасов тканей в наличные.

Это была роковая затея — и почти фатальная. Они вернулись в свою старую квартиру всего за несколько часов до того, как французская полиция начала облаву на парижских евреев, которая стала известна как Rafle du Vel ‘d’hiv, когда более 13000 человек, в том числе около 4000 детей, были заключены в парижский велодром, прежде чем их убрали. перевезен в лагеря для интернированных в Дранси, Компьене, Питивье и Бон-ла-Роланд, а оттуда в Освенцим.Семья Файвелевич сбежала только потому, что консьерж их дома, некая мадам Миньон, предупредила их и помогла им спрятаться в подвале в течение двух дней и ночей, пока на побережье не стало ясно, что можно снова бежать в деревню.

Вернувшись в деревню Вибрае, семье удалось избежать обнаружения в течение еще двух лет, пока их часть западной Франции не была освобождена союзниками где-то в августе 1944 года. Хугетт вспоминает, как танцевала в поле с Морисом, скандировав «Nous sommes juifs! Nous sommes juifs! » (Мы евреи! Мы евреи!) — почти не понимая, что это значит, прожив большую часть последних четырех лет в маскировке в католической семье, но зная, что, наконец, можно было безопасно сказать эти слова.

Читать статью : New York Review of Books

Мэтт Ситон — писатель, живущий в Вестбете.

Архив блога — Страница 3 из 3 — Праздник во Франции

Вечный, изысканный и шикарный. Несколько ключевых слов, которые приходят на ум при описании этой элегантной парижской свадьбы, которая состоялась в историческом частном особняке в нескольких шагах от Елисейских полей.

Кара и Алекс, уроженцы Бостона, устроили уик-энд мероприятия для 100 своих ближайших родственников и друзей.Праздник начался за день до свадьбы круизом с коктейльной вечеринкой по Сене. Гости наслаждались изысканными закусками, шампанским и прекрасным видом на памятники Парижа.

День свадьбы начался с подготовки в бутик-отеле La Reserve, когда невесту баловал талантливый Гарольд Джеймс. Невеста выбрала изысканное свадебное платье Oscar de la Renta с туфлями от Valentino Rockstud. Пара сделала выбор в пользу первого взгляда перед церемонией, за которым последовала фотосессия в Париже, посетив Пале-Рояль, Лувр и Мост Искусств, все время пытаясь сохранить прохладу в необычно жаркую парижскую погоду.

Нетрадиционная свадебная церемония прошла на парадной лестнице особняка и была проведена двоюродными братьями-близнецами жениха. После этого гостей угощали шампанским и канапе во внутреннем дворе с видом на Большой дворец.

Жених и невеста остановились на длинных столах, которые были украшены побегами из белых роз, гортензий и вьющейся ивы. Элегантно оформленные меню высокой печати украшали места каждого гостя, а также персонализированные спичечные коробки в черном и золотом цветах.Изысканная еда и отличные вина были важны для пары, и они даже выбрали Château Boston, французское бордоское вино из области Марго, как дань уважения своему родному городу. Атмосфера официальной вечеринки с черным галстуком сохранялась легкой и энергичной благодаря невероятным музыкантам Inspiration, которые развлекали во время трапезы.

В завершение вечера гостей ждал последний сюрприз — после ужина их проводили вниз в бывшие турецкие бани особняка, которые были преобразованы в ночной клуб с сексуальным освещением, живой музыкой и льющимся шампанским.

Добавить комментарий

Ваш адрес email не будет опубликован. Обязательные поля помечены *

Авторское право © 2021 Es picture - Картинки
top